Dynamin 1 (DNM1) (NM_004408) Human 3' UTR Clone

CAT#: SC207172

3`UTR clone of dynamin 1 (DNM1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DNM1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DNM1
Synonyms DNM; EIEE31
ACCN NM_004408
Insert Size 550 bp
Sequence Data
>SC207172 3'UTR clone of NM_004408
The sequence shown below is from the reference sequence of NM_004408. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGTCCATCCCGTCCTGAGAGCCCCAGGCCCCCCTTCGACCTCTAAACAGATCCCTCCTCTTCTCGGAGA
CCTCCCTTTCCAAGCCTGCCTGGACGGCTGTTCTGTGACTTGACAGTGGCTCCCCCAGCCCCAAAGCCAG
CCCCCTTCATCTGTGACTTAATCTGTTGTAGTGGTGAGCTGATACATTCAGGTGTGACCGTTGGTGAAAA
CTTGTGCCCCTTCTGTGGTATGCCCTTGCCCTGTTCTATAAATATCTATAAATACTCATATATATACACA
CCTACACATGGCCAACCGCCTCGCCTCTAGCGCTGGGAATCAGTCACTGTGCTATCCTTGTGGAGTCTTG
TGGCCCAACTACCAGAGAACGCTGTCCCCCGACATCCCACTCCAAAGTGTGCCACCTCCAGTGAGCCTCC
TTGTCATGCCCGGCCTGTGGACAGCCAGCCCCCGCCATCCCTCCCACCCCCTACCAAGCATGGGGGTGCT
GTGCAGGCAGCCGTGTGGCCTGACAGTTTCTACCAGTCCTGCTGTCCCTCGGCTGAGAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004408.2
Summary 'This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein possesses unique mechanochemical properties used to tubulate and sever membranes, and is involved in clathrin-mediated endocytosis and other vesicular trafficking processes. Actin and other cytoskeletal proteins act as binding partners for the encoded protein, which can also self-assemble leading to stimulation of GTPase activity. More than sixty highly conserved copies of the 3' region of this gene are found elsewhere in the genome, particularly on chromosomes Y and 15. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]'
Locus ID 1759

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.