KCNH4 (NM_012285) Human 3' UTR Clone

CAT#: SC207187

3`UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 4 (KCNH4) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNH4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNH4
Synonyms BEC2; ELK1; Kv12.3
ACCN NM_012285
Insert Size 551
Sequence Data
>SC207187 3'UTR clone of NM_012285
The sequence shown below is from the reference sequence of NM_012285. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTTGAGGCACAGTTTCCAGTCCAGGTCAGACACGTTCCACTGACCCTGGCCCAGGGCCCAGGCCTGTCT
GGGGTGGGCGCTGCCGCTCACCACTCAGGGAGGACCTGGGCCCCTTGGCTTCCTGCCTTGGGGTCAGCAG
CCACCAGCTGGCCTGGTTGGCTCTGGATTTCTGGACTTTTTAATGAAGCGTGGTTACCTCTGACGCTATT
CCCTTTTCCAAGCCTTCCCCAACCTCCCCCTCTGTGAGGGGAGCCACCTGAGGGCTGTGGAACCCAGCAG
GCATGAGATGAACCGCAGTGCCCATTGGGCTGGGCAGATGAGATCCTACTTTCTCCCCAGGACCTGGAGG
CAGGCTGTCTCTCAAGGTGGTCTCTTCTGCTGCTAGCAACTCAAAAATCCCAACAGCACTCCCTATCCTT
TCCCTGACCCCAGACCGCTGCCAAGCCTGTTCTCCCCCATTACAACATGGTCTCACTCAGGGCCTGGACT
GCTCCAAAACTCGCCCAGGTCTCCAGCTCTCCTCTACCACCCAACACCCTGGGCTCACTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012285.2
Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Locus ID 23415

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.