RRM1 (NM_001033) Human 3' UTR Clone

CAT#: SC207191

3`UTR clone of ribonucleotide reductase M1 (RRM1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RRM1
• Synonyms: R1; RIR1; RR1
• ACCN: NM_001033
• Insert Size: 487
• Sequence Data:
  Insert Sequence

  >SC207191 3'UTR clone of NM_001033
  The sequence shown below is from the reference sequence of NM_001033. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCTGATGTGTGGATCCTGAGGAAAGACTTGGAAGAGACCAGCATGTCTTCAGTAGCCAAACTACTTCTT
  GAGCATAGATAGGTATAGTGGGTTTGCTTGAGGTGGTAAGGCTTTGCTGGACCCTGTTGCAGGCAAAAGG
  AGTAATTGATTTAAAGTACTGTTAATGATGATAATGATTTTTTTTTTAAACTCATATATTGGGATTTTCA
  CCAAAATAATGCTTTTGAAAAAAAGAAAAAAAAAACGGATATATTGAGAATCAAAGTAGAAGTTTTAGGA
  ATGCAAAATAAGTCATCTTGCATACAGGGAGTGGTTAAGTAAGGTTTCATCACCCCTTTAGCACTGCTTT
  TCTGAAGACTTCAGTTTTGTTAAGGAGATTTAGTTTTACTGCTTTGACTGGTGGGTCTCTAGAAGCAAAA
  CTGAGTGATAACTCATGAGAAGTACTGATAGGACCTTTATCTGGATATGGTCCTATAGGTTATTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001033.3
• Summary: This gene encodes the large and catalytic subunit of ribonucleotide reductase, an enzyme essential for the conversion of ribonucleotides into deoxyribonucleotides. A pool of available deoxyribonucleotides is important for DNA replication during S phase of the cell cycle as well as multiple DNA repair processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
• Locus ID: 6240