Legumain (LGMN) (NM_001008530) Human 3' UTR Clone

CAT#: SC207221

3`UTR clone of legumain (LGMN) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LGMN"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LGMN
Synonyms AEP; LGMN1; PRSC1
ACCN NM_001008530
Insert Size 501 bp
Sequence Data
>SC207221 3'UTR clone of NM_001008530
The sequence shown below is from the reference sequence of NM_001008530. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGTGTGCCTTGGTCACTACTGAAGAGCTGCCTCCTGGAAGCTTTTCCAAGTGTGAGCGCCCCACCGACTG
TGTGCTGATCAGAGACTGGAGAGGTGGAGTGAGAAGTCTCCGCTGCTCGGGCCCTCCTGGGGAGCCCCCG
CTCCAGGGCTCGCTCCAGGACCTTCTTCACAAGATGACTTGCTCGCTGTTACCTGCTTCCCCAGTCTTTT
CTGAAAAACTACAAATTAGGGTGGGAAAAGCTCTGTATTGAGAAGGGTCATATTTGCTTTCTAGGAGGTT
TGTTGTTTTGCCTGTTAGTTTTGAGGAGCAGGAAGCTCATGGGGGCTTCTGTAGCCCCTCTCAAAAGGAG
TCTTTATTCTGAGAATTTGAAGCTGAAACCTCTTTAAATCTTCAGAATGATTTTATTGAAGAGGGCCGCA
AGCCCCAAATGGAAAACTGTTTTTAGAAAATATGATGATTTTTGATTGCTTTTGTATTTAATTCTGCAGG
TGTTCAAGTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001008530.1
Summary 'This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008]'
Locus ID 5641

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.