Legumain (LGMN) (NM_005606) Human 3' UTR Clone

CAT#: SC207222

3`UTR clone of legumain (LGMN) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LGMN
• Synonyms: AEP; LGMN1; PRSC1
• ACCN: NM_005606
• Insert Size: 501 bp
• Sequence Data:
  Insert Sequence

  >SC207222 3'UTR clone of NM_005606
  The sequence shown below is from the reference sequence of NM_005606. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGTGCCTTGGTCACTACTGAAGAGCTGCCTCCTGGAAGCTTTTCCAAGTGTGAGCGCCCCACCGACTG
  TGTGCTGATCAGAGACTGGAGAGGTGGAGTGAGAAGTCTCCGCTGCTCGGGCCCTCCTGGGGAGCCCCCG
  CTCCAGGGCTCGCTCCAGGACCTTCTTCACAAGATGACTTGCTCGCTGTTACCTGCTTCCCCAGTCTTTT
  CTGAAAAACTACAAATTAGGGTGGGAAAAGCTCTGTATTGAGAAGGGTCATATTTGCTTTCTAGGAGGTT
  TGTTGTTTTGCCTGTTAGTTTTGAGGAGCAGGAAGCTCATGGGGGCTTCTGTAGCCCCTCTCAAAAGGAG
  TCTTTATTCTGAGAATTTGAAGCTGAAACCTCTTTAAATCTTCAGAATGATTTTATTGAAGAGGGCCGCA
  AGCCCCAAATGGAAAACTGTTTTTAGAAAATATGATGATTTTTGATTGCTTTTGTATTTAATTCTGCAGG
  TGTTCAAGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005606.5
• Summary: 'This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008]'
• Locus ID: 5641