GPR183 (NM_004951) Human 3' UTR Clone

CAT#: SC207248

3`UTR clone of G protein-coupled receptor 183 (GPR183) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GPR183
• Synonyms: EBI2; hEBI2
• ACCN: NM_004951
• Insert Size: 545 bp
• Sequence Data:
  Insert Sequence

  >SC207248 3'UTR clone of NM_004951
  The sequence shown below is from the reference sequence of NM_004951. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGTCTTCAAATGGAAAGTGAAATGGATTGTATTTTGGTTTATAGTGACGTAAACTGTATGACAAACTT
  TGCAGGACTTCCCTTATAAAGCAAAATAATTGTTCAGCTTCCAATTAGTATTCTTTTATATTTCTTTCAT
  TGGGCACTTTCCCATCTCCAACTCGGAAGTAAGCCCAAGAGAACAACATAAAGCAAACAACATAAAGCAC
  AATAAAAATGCAAATAAATATTTCATTTTTATTTGTAAACGAATACACCAAAAGGAGGCGCTCTTAATAA
  CTCCCAATGTAAAAAGTTTTGTTTTAATAAAAAATTTAATTATTATTTCTTGCCAACAAATGGCTAGAAA
  GGACTGAATAGATTATATATTGCCAGATGTTAATACTGTAACATACTTTTTAAATAACATATTTCTTAAA
  TCCAAATTTCTCTCAATGTTAGATTTAATTCCCTCAATAACACCAATGTTTTGTTTTGTTTCGTTCTGGG
  TCATAAAACTTTGTTAAGGAACTCTTTTGGAATAAAGAGCAGGATGCTGCAAAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004951.4
• Summary: 'This gene was identified by the up-regulation of its expression upon Epstein-Barr virus infection of primary B lymphocytes. This gene is predicted to encode a G protein-coupled receptor that is most closely related to the thrombin receptor. Expression of this gene was detected in B-lymphocyte cell lines and lymphoid tissues but not in T-lymphocyte cell lines or peripheral blood T lymphocytes. The function of this gene is unknown. [provided by RefSeq, Jul 2008]'
• Locus ID: 1880