Cyclin E1 (CCNE1) (NM_001238) Human 3' UTR Clone

CAT#: SC207262

3`UTR clone of cyclin E1 (CCNE1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCNE1
• Synonyms: CCNE; pCCNE1
• ACCN: NM_001238
• Insert Size: 575 bp
• Sequence Data:
  Insert Sequence

  >SC207262 3'UTR clone of NM_001238
  The sequence shown below is from the reference sequence of NM_001238. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGCGGTAAGAAGCAGAGCAGCGGGCCGGAAATGGCGTGACCACCCCATCCTTCTCCACCAAAGACAGT
  TGCGCGCCTGCTCCACGTTCTCTTCTGTCTGTTGCAGCGGAGGCGTGCGTTTGCTTTTACAGATATCTGA
  ATGGAAGAGTGTTTCTTCCACAACAGAAGTATTTCTGTGGATGGCATCAAACAGGGCAAAGTGTTTTTTA
  TTGAATGCTTATAGGTTTTTTTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACACCAGTGCGTG
  CTCCCGATGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGT
  GGAGGGCCACGGTGGCGTGGCTCTCCTCGCAGGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGT
  TGCGGGCAAGCGTTGTGCAGAGCCCATAGCCAGCTGGGCAGGGGGCTGCCCTCTCCACATTATCAGTTGA
  CAGTGTACAATGCCTTTGATGAACTGTTTTGTAAGTGCTGCTATATCTATCCATTTTTTAATAAAGATAA
  TACTGTTTTTGAGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001238.1
• Summary: 'The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]'
• Locus ID: 898