BCKDH kinase (BCKDK) (NM_005881) Human 3' UTR Clone

CAT#: SC207272

3`UTR clone of branched chain ketoacid dehydrogenase kinase (BCKDK) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BCKDK"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BCKDK
Synonyms BCKDKD; BDK
ACCN NM_005881
Insert Size 544
Sequence Data
>SC207272 3'UTR clone of NM_005881
The sequence shown below is from the reference sequence of NM_005881. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCGGCTCCGCCACATCGATGGCCGGGAGGAAAGCTTCCGGATCTGACCCCACAGCCTTTGGCCTGCTCA
CCCGACCAGCCTGGGCCGCATTCCCTGCAGGACCTCCCGGGTCAGGCAGGGCGGCCCCCTGCTCCACACA
CTGCTGCATCTTGGGTCTCAGGGACCCAGACAGATGGACTTACATGGAGCTGGGCACTGCCCTGCCTCAA
CAGGGTCCATTGCCTCCTCGCCTCCAGAACTTGGAGCAGGGAAGTGGGCACCCTGAGGCCTCCAGCACCA
GTTCCGTCATTCTCGTTCCTGGGGAACCCCCACTCTGACCTGTTATTAAAGTTCACATTTTGAATGCCCT
CTCGGGCCCCGTGTGTGGGGAGGGCAGGTGAACTTTTGTTTCTGCCCCCATTCAGGTTCACTGAGCCCTT
GGGTTGAACTGGTTCGTGTCCCAGTCTCTTACCTGCCCTGAGAGCCTGGCAGGCCAGGAGTAGAATGGGT
CCCAAGTCTGTTGCATGTTTGATTTGGTGGGAGTGGGATGACTGCAGCACCTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005881.2
Summary The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Locus ID 10295

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.