CD13 (ANPEP) (NM_001150) Human 3' UTR Clone

CAT#: SC207299

3`UTR clone of alanyl (membrane) aminopeptidase (ANPEP) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANPEP"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ANPEP
Synonyms APN; CD13; GP150; LAP1; P150; PEPN
ACCN NM_001150
Insert Size 476 bp
Sequence Data
>SC207299 3'UTR clone of NM_001150
The sequence shown below is from the reference sequence of NM_001150. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGCTCCAGTGGTTCACAGAAAACAGCAAATAGTCCCCAGCCCTTGAAGTCACCCGGCCCCCATGCAAGG
TGCCCACATGTGTCCATCCCAGCGGCTGGTGCAGGGCCTCCATTCCTGGAGCCCGAGGCACCAGTGTCCT
CCCCTCAAGGACAAAGTCTCCAGCCCACGTTCTCTCTGCCTGTGAGCCAGTCTAGTTCCTGATGACCCAG
GCTGCCTGAGCACCTCCCAGCCCCTGCCCCTCATGCCAACCCCGCCCTAGGCCTGGCATGGCACCTGTCG
CCCAGTGCCCTGGGGCTGATCTCAGGGAAGCCCAGCTCCAGGGCCAGATGAGCAGAAGCTCTCGATGGAC
AATGAACGGCCTTGCTGGGGGCCGCCCTGTACCCTCTTTCACCTTTCCCTAAAGACCCTAAATCTGAGGA
ATCAACAGGGCAGCAGATCTGTATATTTTTTTCTAAGAGAAAATGTAAATAAAGGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001150.2
Summary 'Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. This membrane-bound zinc metalloprotease is known to serve as a receptor for the HCoV-229E alphacoronavirus as well as other non-human coronaviruses. This gene has also been shown to promote angiogenesis, tumor growth, and metastasis and defects in this gene are associated with various types of leukemia and lymphoma. [provided by RefSeq, Apr 2020]'
Locus ID 290

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.