CD13 (ANPEP) (NM_001150) Human 3' UTR Clone

CAT#: SC207299

3`UTR clone of alanyl (membrane) aminopeptidase (ANPEP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANPEP
• Synonyms: APN; CD13; GP150; LAP1; P150; PEPN
• ACCN: NM_001150
• Insert Size: 476 bp
• Sequence Data:
  Insert Sequence

  >SC207299 3'UTR clone of NM_001150
  The sequence shown below is from the reference sequence of NM_001150. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGCTCCAGTGGTTCACAGAAAACAGCAAATAGTCCCCAGCCCTTGAAGTCACCCGGCCCCCATGCAAGG
  TGCCCACATGTGTCCATCCCAGCGGCTGGTGCAGGGCCTCCATTCCTGGAGCCCGAGGCACCAGTGTCCT
  CCCCTCAAGGACAAAGTCTCCAGCCCACGTTCTCTCTGCCTGTGAGCCAGTCTAGTTCCTGATGACCCAG
  GCTGCCTGAGCACCTCCCAGCCCCTGCCCCTCATGCCAACCCCGCCCTAGGCCTGGCATGGCACCTGTCG
  CCCAGTGCCCTGGGGCTGATCTCAGGGAAGCCCAGCTCCAGGGCCAGATGAGCAGAAGCTCTCGATGGAC
  AATGAACGGCCTTGCTGGGGGCCGCCCTGTACCCTCTTTCACCTTTCCCTAAAGACCCTAAATCTGAGGA
  ATCAACAGGGCAGCAGATCTGTATATTTTTTTCTAAGAGAAAATGTAAATAAAGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001150.2
• Summary: 'Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. This membrane-bound zinc metalloprotease is known to serve as a receptor for the HCoV-229E alphacoronavirus as well as other non-human coronaviruses. This gene has also been shown to promote angiogenesis, tumor growth, and metastasis and defects in this gene are associated with various types of leukemia and lymphoma. [provided by RefSeq, Apr 2020]'
• Locus ID: 290