NPL (NM_030769) Human 3' UTR Clone

CAT#: SC207307

3`UTR clone of N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) (NPL) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NPL
Synonyms C1orf13; C112; NAL; NPL1
ACCN NM_030769
Insert Size 539
Sequence Data
>SC207307 3'UTR clone of NM_030769
The sequence shown below is from the reference sequence of NM_030769. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAACTTGGAAGCTGGTAGCTAGTGCCTCTCTATCAAATCAGGGTTTGCACCTTGAGACATAATCTACC
TTAAATAGTGCATTTTTTTCTCAGGGAATTTTAGATGAACTTGAATAAACTCTCCTAGCAAATGAAATCT
CACAATAAGCATTGAGGTACCTTTTGTGAGCCTTAAAAAGTCTTATTTTGTGAAGGGGCAAAAACTCTAG
GAGTCACAACTCTCAGTCATTCATTTCACAGATTTTTTTGTGGAGAAATTTCTGTTTATATGGATGAAAT
GGAATCAAGAGGAAAATTGTAATTGATTAATTCCATCTGTCTTTAGGAGCTCTCATTATCTCGGTCTCTG
GTTCCTAATCCTATTTTAAAGTTGTCTAATTTTAAACCACTATAATATGTCTTCATTTTAATAAATATTC
ATTTGGAATCTAGGAAAACTCTGAGCTACTGCATTTAGGCAGGCACTTTAATACCAAACTGTAACATGTC
TCAACTGTATACAACTCAAAATACACCAGCTCATTTGGCTGCTCAGTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_030769.1
Summary This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Locus ID 80896

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.