KEAP1 (NM_012289) Human 3' UTR Clone

CAT#: SC207333

3`UTR clone of kelch-like ECH-associated protein 1 (KEAP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KEAP1
• Synonyms: INrf2; KLHL19
• ACCN: NM_012289
• Insert Size: 546
• Sequence Data:
  Insert Sequence

  >SC207333 3'UTR clone of NM_012289
  The sequence shown below is from the reference sequence of NM_012289. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGCAGATTGACCAGCAGAACTGTACCTGTTGAGGCACTTTTGTTTCTTGGGCAAAAATACAGTCCAA
  TGGGGAGTATCATTGTTTTTGTACAAAAACCGGGACTAAAAGAAAAGACAGCACTGCAAATAACCCATCT
  TCCGGGAAGGGAGGCCAGGATGCCTCAGTGTTAAAATGACATCTCAAAAGAAGTCCAAAGCGGGAATCAT
  GTGCCCCTCAGCGGAGCCCCGGGAGTGTCCAAGACAGCCTGGCTGGGAAAGGGGGTGTGGAAAGAGCAGG
  CTTCCAGGAGAGAGGCCCCCAAACCCTCTGGCCGGGTAATAGGCCTGGGTCCCACTCACCCATGCCGGCA
  GCTGTCACCATGTGATTTATTCTTGGATACCTGGGAGGGGGCCAATGGGGGCCTCAGGGGGAGGCCCCCT
  CTGGAAATGTGGTTCCCAGGGATGGGCCTGTACATAGAAGCCACCGGATGGCACTTCCCCACCGGATGGA
  CAGTTATTTTGTTGATAAGTAACCCTGTAATTTTCCAAGGAAAATAAAGAACAGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012289.3
• Summary: This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 9817