KEAP1 (NM_012289) Human 3' UTR Clone

CAT#: SC207333

3`UTR clone of kelch-like ECH-associated protein 1 (KEAP1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KEAP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KEAP1
Synonyms INrf2; KLHL19
ACCN NM_012289
Insert Size 546
Sequence Data
>SC207333 3'UTR clone of NM_012289
The sequence shown below is from the reference sequence of NM_012289. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAGCAGATTGACCAGCAGAACTGTACCTGTTGAGGCACTTTTGTTTCTTGGGCAAAAATACAGTCCAA
TGGGGAGTATCATTGTTTTTGTACAAAAACCGGGACTAAAAGAAAAGACAGCACTGCAAATAACCCATCT
TCCGGGAAGGGAGGCCAGGATGCCTCAGTGTTAAAATGACATCTCAAAAGAAGTCCAAAGCGGGAATCAT
GTGCCCCTCAGCGGAGCCCCGGGAGTGTCCAAGACAGCCTGGCTGGGAAAGGGGGTGTGGAAAGAGCAGG
CTTCCAGGAGAGAGGCCCCCAAACCCTCTGGCCGGGTAATAGGCCTGGGTCCCACTCACCCATGCCGGCA
GCTGTCACCATGTGATTTATTCTTGGATACCTGGGAGGGGGCCAATGGGGGCCTCAGGGGGAGGCCCCCT
CTGGAAATGTGGTTCCCAGGGATGGGCCTGTACATAGAAGCCACCGGATGGCACTTCCCCACCGGATGGA
CAGTTATTTTGTTGATAAGTAACCCTGTAATTTTCCAAGGAAAATAAAGAACAGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012289.3
Summary This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 9817

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.