GLS2 (NM_013267) Human 3' UTR Clone

CAT#: SC207351

3`UTR clone of glutaminase 2 (liver mitochondrial) (GLS2) nuclear gene encoding mitochondrial protein for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GLS2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GLS2
Synonyms GA; GLS; hLGA; LGA
ACCN NM_013267
Insert Size 546
Sequence Data
>SC207351 3'UTR clone of NM_013267
The sequence shown below is from the reference sequence of NM_013267. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTGTCCAAAGAGAACTTAGAAAGCATGGTATGAGCACAGGTCATGGACAGCCCCTGCTCAAGAAAAAGC
ATGAGCTGGCCACACATGTAATCCATAACCACCAAAAATACTATGGAGAGCTACACTGCTTCAGTGGGGA
CCAAGCAGTCATTTGGTGACTTAGGCTAGTGCTTTCTATGGGAGTCAAAATACCCCATTCCCTCAGCAGA
CAGAGTACAGAGAAGGGCCTCAGAGGACACCTGCAGTACAGCTATCCAGAGAGACTGGGCTTCAAGGTAC
AGCCTAATGGCTTGCCCCACTCAAAACCATCCCAGCTCTTCACCCAGGTCTCCTCTTCCTCTCCCTGAAG
AAACCATCATGAGAGAGATACTCTGGTGGAGGGACTCTAGCTACCATGCACATGTACATATCCACAGAAT
ATGGGAAGTGGGAATGGCTATATACATGGCTTTAGTAGTCTGGAGAAATCTACTCCCCTTGGCCAGGACA
TGCTGCTGCTACTGCTAACAGCCAATTTTATAGACAGAGAAAGTATTTTGTGTTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013267.2
Summary The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Locus ID 27165

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.