GBP2 (NM_004120) Human 3' UTR Clone

CAT#: SC207355

3`UTR clone of guanylate binding protein 2 interferon-inducible (GBP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GBP2
• Synonyms: DKFZp451C2311
• ACCN: NM_004120
• Insert Size: 561 bp
• Sequence Data:
  Insert Sequence

  >SC207355 3'UTR clone of NM_004120
  The sequence shown below is from the reference sequence of NM_004120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGAAGCAAATCATTGGAGCCAATATGTAACATACTCTAAAAGTCCAAGGAGCAAAATTTGCCTGTCCAG
  CTCCCTCTCCCCAAGAAACAACATGAATGAGCAACTTCAGAGTGTCAAACAACTGCCATTAAACTTAACT
  CAAAATCATGATGCATGCATTTTTGTTGAACCATAAAGTTTGCAAAGTAAAGGTTAAGTATGAGGTCAAT
  GTTTTACCTACAGAGCAATTCAACTCATGCTTATTTATAGTACTAACTTTTAATATGATCTTTAACTAAA
  TCCTATATTTGAAATCATACACAAGGACTCAAGAGAGATATTGTGTAACTAGGATGCATTTTCCAATGAG
  ATATCTTGCAGTTTCTGTTCTGGGTAGATTTTTTTCTCTCATATGCACCACCCTTACTGTATATTCAGTC
  CTATACTCTTATTCAGGGATTTAACTATGGTCGTAGCATAGGGCTGAAGTGTTGTGAATATGATGAAAAT
  GTGATGAGACCAAACAAACCATGGGGCACAGTAGAGCATCACTCCTGCCAAGTGGTCTTTGTATGGCATG
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004120.3
• Summary: 'This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]'
• Locus ID: 2634