KCNN3 (NM_170782) Human 3' UTR Clone

CAT#: SC207364

3`UTR clone of potassium intermediate/small conductance calcium-activated channel subfamily N member 3 (KCNN3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNN3
• Synonyms: hSK3; KCa2.3; SK3; SKCA3
• ACCN: NM_170782
• Insert Size: 543 bp
• Sequence Data:
  Insert Sequence

  >SC207364 3'UTR clone of NM_170782
  The sequence shown below is from the reference sequence of NM_170782. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGTACACAAGTTCAAGCAGTTGCTAAATAAATCTCCCCACTCCAGAAGCATTACCCATAGGTCTTAAGA
  TGCAAATCAACTCTCTCCTGGTCGCTTTGCCATCAAGAAACATTCAGACCAGGGAACGGAAAGAAGAGAG
  ACCGAGCTAATTAACTAACTCATGTTCATTCAGCGTGCTTGGTCCGACATGCCTTGAAACCAGAAATCTA
  ATCTCTGTTTAGGTGCCTCTACTTGGGAGCGGGAAGAGGAGATGACAGGAAGCGACGCCTCTGGCAGGGC
  CCTTGCTGCAGAGTTGGTGGAGAACAGAAATCCACGCTCAATCTCAGGTCTTCACGCGGGGGGTGGGGGT
  CAGATGCACTGAAGTAGCCAACAGCGAAGCCAGTCCAGAAGAGGGGTCCGCTGGGAGGGAGGGTTGTGTC
  AGGCTTGGGGGATGGGCTCTTCGCCATGGGGGTCTTTGAACACACCTCTCTCCTTTCCTTTTGTCTACGG
  AAGCCTCTGGGTGACAAAAGTAAAAGAGAGCTGCCCACAACTTGCCAAAACAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_170782.1
• Summary: 'Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]'
• Locus ID: 3782