CAMKK2 (NM_172214) Human 3' UTR Clone

CAT#: SC207375

3`UTR clone of calcium/calmodulin-dependent protein kinase kinase 2 beta (CAMKK2) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAMKK2
• Synonyms: CAMKK; CAMKKB
• ACCN: NM_172214
• Insert Size: 550
• Sequence Data:
  Insert Sequence

  >SC207375 3'UTR clone of NM_172214
  The sequence shown below is from the reference sequence of NM_172214. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACCAGGGAATGTGAGTCCCTGTCTGAGCTCAAGACCTAGAAAATAAGTCCCCTTCCTGCCTGTTGCAAA
  GTAACGTAAGAGTTCCCTCACCCGAGTGGATGCAGACCTTCTTGCTGTCAGCCACCCTTCCTTCATACAC
  ATAGCCAGCCCAGGTGACCAGAACCTCCCAGGACAGATGAGGCTTTGTGTCCTTATGAGACTGGGAGAAC
  CTGCTGGGCACCCCTGCTGCAGGTGCTGTGGTGGGTGGGGACCCCACTGCCCTTCCCACTGAGCACATCA
  TGGCTACCTGACTTGGTGGGAGCTCCAGGCAGTCACTTCTGTTTCTTAAACATAGCTTTACTGAGGTACA
  ATTCACATACCATGTAATTCACCCACGGGAAGTGTATGATTCAGTGGTTTCTAATACAGACTTCTGCAGC
  CATTACCACCGTCAACTTTACGACATTTTCATCAGCCCAAGAAGACACCCTACACTCCTTAGCTGTCCCC
  ATCCAACTCCCCCACCCCAGTAACCACTCAGAATAGGTATGGATTTGCCTATTCTGGACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_172214.2
• Summary: The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
• Locus ID: 10645