Angiopoietin like 4 (ANGPTL4) (NM_001039667) Human 3' UTR Clone

CAT#: SC207382

3`UTR clone of angiopoietin-like 4 (ANGPTL4) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANGPTL4
• Synonyms: ANGPTL2; ARP4; FIAF; HARP; HFARP; NL2; PGAR; pp1158; TGQTL; UNQ171
• ACCN: NM_001039667
• Insert Size: 508
• Sequence Data:
  Insert Sequence

  >SC207382 3'UTR clone of NM_001039667
  The sequence shown below is from the reference sequence of NM_001039667. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCACCATGTTGATCCAGCCCATGGCAGCAGAGGCAGCCTCCTAGCGTCCTGGCTGGGCCTGGTCCCAGG
  CCCACGAAAGACGGTGACTCTTGGCTCTGCCCGAGGATGTGGCCGTTCCCTGCCTGGGCAGGGGCTCCAA
  GGAGGGGCCATCTGGAAACTTGTGGACAGAGAAGAAGACCACGACTGGAGAAGCCCCCTTTCTGAGTGCA
  GGGGGGCTGCATGCGTTGCCTCCTGAGATCGAGGCTGCAGGATATGCTCAGACTCTAGAGGCGTGGACCA
  AGGGGCATGGAGCTTCACTCCTTGCTGGCCAGGGAGTTGGGGACTCAGAGGGACCACTTGGGGCCAGCCA
  GACTGGCCTCAATGGCGGACTCAGTCACATTGACTGACGGGGACCAGGGCTTGTGTGGGTCGAGAGCGCC
  CTCATGGTGCTGGTGCTGTTGTGTGTAGGTCCCCTGGGGACACAAGCAGGCGCCAATGGTATCTGGGCGG
  AGCTCACAGAGTTCTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001039667.1
• Summary: This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
• Locus ID: 51129