TAC1 (NM_013998) Human 3' UTR Clone

CAT#: SC207402

3`UTR clone of tachykinin precursor 1 (TAC1) transcript variant delta for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAC1
• Synonyms: Hs.2563; NK2; NKNA; NPK; TAC2
• ACCN: NM_013998
• Insert Size: 570 bp
• Sequence Data:
  Insert Sequence

  >SC207402 3'UTR clone of NM_013998
  The sequence shown below is from the reference sequence of NM_013998. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGCTTATGAAAGGAGTGCAATGCAGAATTATGAAAGAAGACGTTAATAAACTACCTAACATTATTTATT
  CAGCTTCATTTGTGTCAATGGGCAATGACAGGTAAATTAAGACATGCACTATGAGGAATAATTATTTATT
  TAATAACAATTGTTTGGGGTTGAAAATTCAAAAAGTGTTTATTTTTCATATTGTGCCAATATGTATTGTA
  AACATGTGTTTTAATTCCAATATGATGACTCCCTTAAAATAGAAATAAGTGGTTATTTCTCAACAAAGCA
  CAGTGTTAAATGAAATTGTAAAACCTGTCAATGATACAGTCCCTAAAGAAAAAAAATCATTGCTTTGAAG
  CAGTTGTGTCAGCTACTGCGGAAAAGGAAGGAAACTCCTGACAGTCTTGTGCTTTTCCTATTTGTTTTCA
  TGGTGAAAATGTACTGAGATTTTGGTATTACACTGTATTTGTATCTCTGAAGCATGTTTCATGTTTTGTG
  ACTATATAGAGATGTTTTTAAAAGTTTCAATGTGATTCTAATGTCTTCATTTCATTGTATGATGTGTTGT
  GATAGCTAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013998.2
• Summary: 'This gene encodes four products of the tachykinin peptide hormone family, substance P and neurokinin A, as well as the related peptides, neuropeptide K and neuropeptide gamma. These hormones are thought to function as neurotransmitters which interact with nerve receptors and smooth muscle cells. They are known to induce behavioral responses and function as vasodilators and secretagogues. Substance P is an antimicrobial peptide with antibacterial and antifungal properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]'
• Locus ID: 6863