KCNN4 (NM_002250) Human 3' UTR Clone

CAT#: SC207502

3`UTR clone of potassium intermediate/small conductance calcium-activated channel subfamily N member 4 (KCNN4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNN4
• Synonyms: DHS2; hIKCa1; hKCa4; hSK4; IK; IK1; IKCA1; KCa3.1; KCA4; SK4
• ACCN: NM_002250
• Insert Size: 550 bp
• Sequence Data:
  Insert Sequence

  >SC207502 3'UTR clone of NM_002250
  The sequence shown below is from the reference sequence of NM_002250. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCAGCAGTCCAAGTAGCTGGACCCACGAGGAGGAACCAGGCTACTTTCCCCAGTACTGAGGTGGTGGA
  CATCGTCTCTGCCACTCCTGACCCAGCCCTGAACAAAGCACCTCAAGTGCAAGGACCAAAGGGGGCCCTG
  GCTTGGAGTGGGTTGGCTTGCTGATGGCTGCTGGAGGGGACGCTGGCTAAAGTGGGTAGGCCTTGGCCCA
  CCTGAGGCCCCAGGTGGGAACATGGTCACCCCCACTCTGCATACCCTCATCAAAAACACTCTCACTATGC
  TGCTATGGACGACCTCCAGCTCTCAGTTACAAGTGCAGGCGACTGGAGGCAGGACTCCTGGGTCCCTGGG
  AAAGAGGGTACTAGGGGCCCGGATCCAGGATTCTGGGAGGCTTCAGTTACCGCTGGCCGAGCTGAAGAAC
  TGGGTATGAGGCTGGGGCGGGGCTGGAGGTGGCGCCCCCTGGTGGGACAACAAAGAGGACACCATTTTTC
  CAGAGCTGCAGAGAGCACCTGGTGGGGAGGAAGAAGTGTAACTCACCAGCCTCTGCTCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002250.2
• Summary: 'The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]'
• Locus ID: 3783