GAD65 (GAD2) (NM_000818) Human 3' UTR Clone

CAT#: SC207536

3`UTR clone of glutamate decarboxylase 2 (pancreatic islets and brain 65kDa) (GAD2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAD2
• Synonyms: GAD65
• ACCN: NM_000818
• Insert Size: 563 bp
• Sequence Data:
  Insert Sequence

  >SC207536 3'UTR clone of NM_000818
  The sequence shown below is from the reference sequence of NM_000818. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATAGAACGCCTTGGACAAGATTTATAATAACCTTGCTCACCAAGCTGTTCCACTTCTCTAGAGAACATG
  CCCTCAGCTAAGCCCCCTACTGAGAAACTTCCTTTGAGAATTGTGCGACTTCACAAAATGCAAGGTGAAC
  ACCACTTTGTCTCTGAGAACAGACGTTACCAATTATGGAGTGTCACCAGCTGCCAAAATCGTAGGTGTTG
  GCTCTGCTGGTCACTGGAGTAGTTGCTACTCTTCAGAATATGGACAAAGAAGGCACAGGTGTAAATATAG
  TAGCAGGATGAGGAACCTCAAACTGGGTATCATTTTGCACGTGCTCTTCTGTTCTCAAATGCTAAATGCA
  AACACTGTGTATTTATTAGTTAGGTGTGCCAAACTACCGTTCCCAAATTGGTGTTTCTGAATGACATCAA
  CATTCCCCCAACATTACTCCATTACTAAAGACAGAAAAAAATAAAAACATAAAATATACAAACATGTGGC
  AACCTGTTCTTCCTACCAAATATAAACTTGTGTATGATCCAAGTATTTTATCTGTGTTGTCTCTCTAAAC
  CCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000818.2
• Summary: 'This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]'
• Locus ID: 2572