IFNGR1 (NM_000416) Human 3' UTR Clone

CAT#: SC207561

3`UTR clone of interferon gamma receptor 1 (IFNGR1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IFNGR1
• Synonyms: CD119; IFNGR; IMD27A; IMD27B
• ACCN: NM_000416
• Insert Size: 559 bp
• Sequence Data:
  Insert Sequence

  >SC207561 3'UTR clone of NM_000416
  The sequence shown below is from the reference sequence of NM_000416. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATAGACCAACAGAAGATTCCAAAGAATTTTCATGAGATCAGCTAAGTTGCACCAACTTTGAAGTCTGATT
  TTCCTGGACAGTTTTCTGCTTTAATTTCATGAAAAGATTATGATCTCAGAAATTGTATCTTAGTTGGTAT
  CAACCAAATGGAGTGACTTAGTGTACATGAAAGCGTAAAGAGGATGTGTGGCATTTTCACTTTTGGCTTG
  TAAAGTACAGACTTTTTTTTTTTTTTAAACAAAAAAAGCATTGTAACTTATGAACCTTTACATCCAGATA
  GGTTACCAGTAACGGAACAGTATCCAGTACTCCTGGTTCCTAGGTGAGCAGGTGATGCCCCAGGGACCTT
  TGTAGCCACTTCACTTTTTTTCTTTTCTCTGCCTTGGTATAGCATATGTTTTTGTAAGTTTATGCATACA
  GTAATTTTAAGTAATTTCAGAAGAAATTCTGCAAGCTTTTCAAAATTGGACTTAAAATCTAATTCAAACT
  AATAGAATTAATGGAATATGTAAATAGAAACGTGTATATTTTTTATGAAACATTACAGTTAGAGATTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000416.2
• Summary: 'This gene (IFNGR1) encodes the ligand-binding chain (alpha) of the gamma interferon receptor. Human interferon-gamma receptor is a heterodimer of IFNGR1 and IFNGR2. A genetic variation in IFNGR1 is associated with susceptibility to Helicobacter pylori infection. In addition, defects in IFNGR1 are a cause of mendelian susceptibility to mycobacterial disease, also known as familial disseminated atypical mycobacterial infection. [provided by RefSeq, Jul 2008]'
• Locus ID: 3459