BRMS1 (NM_015399) Human 3' UTR Clone

CAT#: SC207572

3`UTR clone of breast cancer metastasis suppressor 1 (BRMS1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BRMS1
• Synonyms: DKFZp564A063
• ACCN: NM_015399
• Insert Size: 542
• Sequence Data:
  Insert Sequence

  >SC207572 3'UTR clone of NM_015399
  The sequence shown below is from the reference sequence of NM_015399. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAATCGGATGGACCTTGACCCTGCTGTTCACAGCCAGGGGGACCCTCAGAGCAGCTGGCACTGCACCCAG
  GATTCTCGTCTTCCTCCTGCAGACAGGCGGACCCACAGGCCCCTCAGGGTCTGCCCAGCCAGGCTCCTGT
  GGTGCTGCTGGGCCCTCCCACTCCATCTGGCACTGGCCTGGACTCCTCCTCTGCCCTCCTCGAGGCCTGC
  ACAGCTGTGGCCGTGGAGCTGACCTGACCAGGCAAGGCTGCTGTCTCCATCCCTGAGCCGCCTGCCACCT
  CCCACTCCTGAAGATCCATCTCTTGGGGCTCCCCTGACAGAGAAGACAGCCGAAGTCAAAGCCACATCCT
  CTTGCTGATGTTGGATGCAGGCTGTCCGGCCTCAGGGCCAGGGAGCCAGTTTCCACTGTGCGGGAACTCT
  GAGTCAGACGTGATTATCTGGGGGTCTGTCCACCCTGGCTGGATCTGGAGGCAAGATGCCAGGCCCCCCA
  GGTGTTCTCAGGGCAGTTCTTGGTGTCTGCTTCTCAGATTCCAAGGACTGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015399.3
• Summary: This gene reduces the metastatic potential, but not the tumorogenicity, of human breast cancer and melanoma cell lines. The protein encoded by this gene localizes primarily to the nucleus and is a component of the mSin3a family of histone deacetylase complexes (HDAC). The protein contains two coiled-coil motifs and several imperfect leucine zipper motifs. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 25855