CREM (NM_001881) Human 3' UTR Clone

CAT#: SC207591

3`UTR clone of cAMP responsive element modulator (CREM) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CREM
• Synonyms: CREM-2; hCREM-2; ICER
• ACCN: NM_001881
• Insert Size: 557 bp
• Sequence Data:
  Insert Sequence

  >SC207591 3'UTR clone of NM_001881
  The sequence shown below is from the reference sequence of NM_001881. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTGCAATTCGATATGATACAGTGCTAGCTTTAAGTCTTCTCTAGTTATATTGAAGCAACTCAGGTTTT
  GGCATTAAATTGTTCCATTTTAAAATGCATCATTAATACCTAAACTGTATCATAGAATGAAAGTATATGT
  TAAAAAGTGAGATCTTTGTATTGACAGCTGTCATATAATTTTGAAAAGTAAAAATTTTGACTGCCGAATA
  TAGAAGAAAATTTTGGGGTAAAAAGGAGAATTTTTCCTATTTACATGTTTATATTAATCTCTAGTAAAAC
  ATTGTTTTTGTTGTCTTTATGATGCATGCGAACATAAATGTCTGTATTTCATTCTTGTTGGCTTTTGTTA
  CCCACAATTACATACTATTCTTACTAATCTGAGAGTTTTCTAAAGTATGTTTTCAATGTTTCACTACTCT
  CTACTCTGTTAATTTGTGCTACAGTTTTTCCTAAAAGAGAATGGAAAAATGATTTAATTTTTTAAACTGT
  AGCAATTGGATAGATAATTTTATTTGAAATTTTACACACTGAAAGCTCTAAATAAACAGATACATTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001881.2
• Summary: 'This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008]'
• Locus ID: 1390