PSMD7 (NM_002811) Human 3' UTR Clone

CAT#: SC207611

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 7 (PSMD7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMD7
• Synonyms: MOV34; P40; Rpn8; S12
• ACCN: NM_002811
• Insert Size: 574 bp
• Sequence Data:
  Insert Sequence

  >SC207611 3'UTR clone of NM_002811
  The sequence shown below is from the reference sequence of NM_002811. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTGATGTAAAGAAAGAGGAGAAAAAGGAGAAAAAGTAAAACATGTATTAAATAGCTTTTTTAATTTGT
  AAATTAAAATCTTACAAACTAAATCAGTGTGCTGCTAGAGGGTTCTTTTTCACTTGACATGCTTATTAGA
  AAGCTGACCCAACAAGAGCTCTCTGCCTCCGGTCACTCTTGCTGTGGTGCTACGTGGAAGTGAATGGAGA
  CTGATCTCAAATCTGAACTGCAGCTTTCGCTGCTGTGAGTTGGGGATATGATAGTCAGCTCAGGCTTCAG
  ATTGTATGAGAAAAATGAAGAGAAGTCAACAAATATTTTGGTACTCTTCATTCATTTATCTCTAAAACCA
  GGAGTTGAATTTTCCTCATCTTGAAAGACTCTTGGGGTCTGTTTCTGGTATTTTACAAAATTGCTAAGTG
  GAATGCATGAATTGCATTATGTTCTCTGGTAACACGTAGAGTTCAGACCCTTCTGAACTCTGTTGATAAT
  ACCACACCATGTTCTGGACCCATAGCTCTGGCATCCTCAGGGGTTGTGATCCAGCTCCATATATTGTTTA
  CCTTCAAAGATACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002811.3
• Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]'
• Locus ID: 5713