ARSB (NM_198709) Human 3' UTR Clone

CAT#: SC207651

3`UTR clone of arylsulfatase B (ARSB) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARSB
• Synonyms: ASB; G4S; MPS6
• ACCN: NM_198709
• Insert Size: 612 bp
• Sequence Data:
  Insert Sequence

  >SC207651 3'UTR clone of NM_198709
  The sequence shown below is from the reference sequence of NM_198709. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGGACTCTTCACCGTACTGGCCTGAGTGCTCGCTGCTGTTGTAGCTACCACCAACTTTCTACTGAAGAT
  GATAACCCAGGGCATAAGAAATGACTTCAGACCCAAGGTTCTGAAAGGGCCCCTCAAGGCCTCGGGTGGC
  TCCTGCAGAAGTGGCAGAAGAGGCGGGAACTAGGAACCTGGCATCATAGGAAAAGTGCCTTCTCCAAGAA
  AGAAGGGGCCCCAGGAGGCTGTCTTACTTAGATCAACCATAAACTACCACAGATGGGTCATTTCTTATAT
  TATTTCAAAATATCTTTGAAGATGAGAATTCATTTGTGTCCTTCATAGACCAAAGTTCTTTGTGTTACCT
  TTTCCCAAAAGTAAATTCCTTTCCCTTTATTCATTCCTTGTGGAAATAAAATGCAAGCCCTTTATACTTG
  TCTTACAGTAATATGGCACATGTAGCTTACTTTTGAGCATCCCAGTGAATAATGTTTGGAACTTTTCTTA
  TTACCTAATAGCATATAGAGAAGAGTGAAGTCAGCTAAAAACAGAAATTTTGAAAAGCCATCTTCAGGAA
  AATGTAGGCCCAGATGCTTTCCTCCACCTTTTTTGACAGGCTGCCACATACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198709.2
• Summary: 'Arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes sulfate groups of N-Acetyl-D-galactosamine, chondriotin sulfate, and dermatan sulfate. The protein is targeted to the lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder resulting from a deficiency of arylsulfatase B. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2016]'
• Locus ID: 411