OGG1 (NM_016819) Human 3' UTR Clone

CAT#: SC207688

3`UTR clone of 8-oxoguanine DNA glycosylase (OGG1) nuclear gene encoding mitochondrial protein transcript variant 1b for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: OGG1
• Synonyms: HMMH; HOGG1; MUTM; OGH1
• ACCN: NM_016819
• Insert Size: 567 bp
• Sequence Data:
  Insert Sequence

  >SC207688 3'UTR clone of NM_016819
  The sequence shown below is from the reference sequence of NM_016819. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCGGTGAGTGTACCTAGGTGTCCTCCCTAGGTTTCCTCTCCTCCAGCCCAGACCCAGTGGACTCTTCCA
  CCACCGCCCCAGGTGGCCCTAAAGGACTCTCCAGCCACCCCTGTCCCAACCCCAGTGGATTCTCATTGCC
  TTCGGCCCTGTTCCCCAAGGACTCTTCCACCTCCCAACACTGTCACTAGTCTCACCAGCCCTGACCCCAG
  TGTACCCTCCTCCCCACACAGACTCCACCCTCCTACAGGTGCTGTTCAGTGCCGACCTGCGCCAATCCCG
  CCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAAGGGCCGGAAGGCTAGATGGGGCACCCT
  GGACAAAGAAATTCCCCAAGCACCTTCCCCTCCATTCCCCACTTCTCTCTCCCCATCCCCACCCAGTCTC
  ATGTTGGGGAGGGGCCTCCCTGTGACTACCTCAAAGGCCAGGCACCCCCAAATCAAGCAGTCAGTTTGCA
  CAACAAGATGGGGTGGGGGATATTGAGGGAGACAGCGCTAAGGATGGTTTTATCTTCCCTTTATTACAAG
  AAGGAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_016819.3
• Summary: 'This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]'
• Locus ID: 4968