HDAC1 (NM_004964) Human 3' UTR Clone

CAT#: SC207708

3`UTR clone of histone deacetylase 1 (HDAC1) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HDAC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HDAC1
Synonyms GON-10; HD1; KDAC1; RPD3; RPD3L1
ACCN NM_004964
Insert Size 582 bp
Sequence Data
>SC207708 3'UTR clone of NM_004964
The sequence shown below is from the reference sequence of NM_004964. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGAGGAGGTCAAGTTGGCCTGAATGGACCTCTCCAGCTCTGGCTTCCTGCTGAGTCCCTCACGTTTCTT
CCCCAACCCCTCAGATTTTATATTTTCTATTTCTCTGTGTATTTATATAAAAATTTATTAAATATAAATA
TCCCCAGGGACAGAAACCAAGGCCCCGAGCTCAGGGCAGCTGTGCTGGGTGAGCTCTTCCAGGAGCCACC
TTGCCACCCATTCTTCCCGTTCTTAACTTTGAACCATAAAGGGTGCCAGGTCTGGGTGAAAGGGATACTT
TTATGCAACCATAAGACAAACTCCTGAAATGCCAAGTGCCTGCTTAGTAGCTTTGGAAAGGTGCCCTTAT
TGAACATTCTAGAAGGGGTGGCTGGGTCTTCAAGGATCTCCTGTTTTTTTCAGGCTCCTAAAGTAACATC
AGCCATTTTTAGATTGGTTCTGTTTTCGTACCTTCCCACTGGCCTCAAGTGAGCCAAGAAACACTGCCTG
CCCTCTGTCTGTCTTCTCCTAATTCTGCAGGTGGAGGTTGCTAGTCTAGTTTCCTTTTTGAGATACTATT
TTCATTTTTGTGAGCCTCTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004964.2
Summary 'Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]'
Locus ID 3065

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.