HDAC1 (NM_004964) Human 3' UTR Clone

CAT#: SC207708

3`UTR clone of histone deacetylase 1 (HDAC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HDAC1
• Synonyms: GON-10; HD1; KDAC1; RPD3; RPD3L1
• ACCN: NM_004964
• Insert Size: 582 bp
• Sequence Data:
  Insert Sequence

  >SC207708 3'UTR clone of NM_004964
  The sequence shown below is from the reference sequence of NM_004964. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGAGGAGGTCAAGTTGGCCTGAATGGACCTCTCCAGCTCTGGCTTCCTGCTGAGTCCCTCACGTTTCTT
  CCCCAACCCCTCAGATTTTATATTTTCTATTTCTCTGTGTATTTATATAAAAATTTATTAAATATAAATA
  TCCCCAGGGACAGAAACCAAGGCCCCGAGCTCAGGGCAGCTGTGCTGGGTGAGCTCTTCCAGGAGCCACC
  TTGCCACCCATTCTTCCCGTTCTTAACTTTGAACCATAAAGGGTGCCAGGTCTGGGTGAAAGGGATACTT
  TTATGCAACCATAAGACAAACTCCTGAAATGCCAAGTGCCTGCTTAGTAGCTTTGGAAAGGTGCCCTTAT
  TGAACATTCTAGAAGGGGTGGCTGGGTCTTCAAGGATCTCCTGTTTTTTTCAGGCTCCTAAAGTAACATC
  AGCCATTTTTAGATTGGTTCTGTTTTCGTACCTTCCCACTGGCCTCAAGTGAGCCAAGAAACACTGCCTG
  CCCTCTGTCTGTCTTCTCCTAATTCTGCAGGTGGAGGTTGCTAGTCTAGTTTCCTTTTTGAGATACTATT
  TTCATTTTTGTGAGCCTCTTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004964.2
• Summary: 'Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008]'
• Locus ID: 3065