CYP26A1 (NM_057157) Human 3' UTR Clone

CAT#: SC207710

3`UTR clone of cytochrome P450 family 26 subfamily A polypeptide 1 (CYP26A1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP26A1
• Synonyms: CP26; CYP26; P450RAI; P450RAI1
• ACCN: NM_057157
• Insert Size: 599 bp
• Sequence Data:
  Insert Sequence

  >SC207710 3'UTR clone of NM_057157
  The sequence shown below is from the reference sequence of NM_057157. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACAATCTCCCTGCAAGATTCACCCATTTCCATGGGGAAATCTGATGAGCTTGAATGTTCAAACCTGAG
  ACTTATTGGAAGTGTACATATGAGTTTTTAAGGAGTGTTGTGTTGACTTTATATTTAATTTCTAAATGTA
  TATTATAATATTTATGTGTTTTGACTATACTACCACAATCTTTAAATATTAAAATAATGAATTTGTATCA
  TTTCCAAATAAAGTAAAATTTGAAGGTACTTTTCTGGTATTTTAAGATTCCTGTTGGGTAAAACTCACCA
  GTTTAGTATTTTCTTAGTGTATTTAACCAGATTTTACAATGCCTACCTGGACTTATTTGTCATCTTTGCA
  TCTGTTTTCTGTGAGAAGAAATCTTAGCTGTTTTTTATGTTAACAGTTATTAGAAAATATATGTCTGTGT
  GTGTTATTCCAGACGTATCTCTGTAAATTCTTCTACAGTCACTTAGATTCCCTATTTGGAAAATTGATCC
  AAGTTAATTTAATTTTTTTTTGGTTTGCTGTACTTTAGGGAAAGATGAACCTGAAAAGGTAACACTGAGA
  ACTGTCACTCTAACCTCTCCAGCTTATCTAACATGTCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_057157.2
• Summary: 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 1592