TFIIB (GTF2B) (NM_001514) Human 3' UTR Clone

CAT#: SC207717

3`UTR clone of general transcription factor IIB (GTF2B) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GTF2B
Synonyms TF2B; TFIIB
ACCN NM_001514
Insert Size 579 bp
Sequence Data
>SC207717 3'UTR clone of NM_001514
The sequence shown below is from the reference sequence of NM_001514. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGGACAAACTACCACAGCTATAAATTGAGGCAGCTAACGTCAAATTCTTGAATACAAAACTTTGCCTGT
TGTACATAGCCTATACAAAATGCTGGGTTGAGCCTTTCATGAGGAAAAACAAAAGACATGGTACGCATTC
CAGGGCTGAATACTATTGCTTGGCATTCTGTATGTATATACTAGTGAAACATATTTAATGATTTAAATTT
CTTATCAAATTTCTTTTGTAGCAATCTAGGAAACTGTATTTTGGAAGATATTTGAAATTATGTAATTCTT
GAATAAAACATTTTTCAAAACTCAAGTTTTTGTTATATGTTACATGTAACTTATGATACATAATTACAAA
TAATGCAAATCATTGCAGCTAATAAAGCTGATAGACTTTATTTCCATTACTTATATATACATAGTTTTTT
ATTTTAATAAATTTATGGAAAGAGCAAAAGCTTTTGAGAACCATTGTTAACATCAACATCATAGTTTCCA
GTTTGAAAGGATGTGTATGTGAGATTTATTATGTATATTATTAAACAAGAAGTGATGAGCTTGGGCCTTG
AAAGGCACCAGCTTGAGAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001514.5
Summary 'This gene encodes the general transcription factor IIB, one of the ubiquitous factors required for transcription initiation by RNA polymerase II. The protein localizes to the nucleus where it forms a complex (the DAB complex) with transcription factors IID and IIA. Transcription factor IIB serves as a bridge between IID, the factor which initially recognizes the promoter sequence, and RNA polymerase II. [provided by RefSeq, Jul 2008]'
Locus ID 2959

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.