Phospholipase D2 (PLD2) (NM_002663) Human 3' UTR Clone

CAT#: SC207781

3`UTR clone of phospholipase D2 (PLD2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLD2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PLD2
Synonyms PLD1C
ACCN NM_002663
Insert Size 585 bp
Sequence Data
>SC207781 3'UTR clone of NM_002663
The sequence shown below is from the reference sequence of NM_002663. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTAGCAAGGAGGGCATGATCCCCCTAGAAGTGTGGACATAGTTGAGGCCCCCGTCAGGGAGAGGTCACCA
GCTGCTGTGCCCCACCACGTCTGGCTCCCTGCCCCTTAACCCCAAGGACTGAGGGCAGTGCCCTTTGAGA
TCTGGGGAGGCAGGCATTCCTGAAGGGAACTAGAGGTGTTACAGAGGACCCTTACGTGAGAAATAGCTGA
AAAGGGCACTCCCAACCCTGGGCTGGGGAGGAGGAGAGAGTCCCAGAGCTCATCCCCCCTGCTGCCCAGT
GCAAACCACTTCTCCATGCTGCAAAGGAGAAGCACAGCTCCTGCCAGGGTGAGCAGGGTCAAGCCTCTTA
TTCCAGGAGAAGGGGGCTCTGCCCCAGGCCCTACTACCCATTGTTCCCTTCCTCTTCCTGCCCTTGAACC
CCCTCCCTGTCCCAGGGCCCTCCCAGCCCATTGCTGCCAAGGTGGAGGGAAGGATAAAGCCACTTCTGGC
TTCAGCCCCCACCAGGGGAAGGAAGGAGGGCACATTAACTCCCTCCACCAGCCTGCTGACAGACACTAAC
TTTGTATCCGTTCAATAAGCATTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002663.3
Summary 'The protein encoded by this gene catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. The activity of the encoded enzyme is enhanced by phosphatidylinositol 4,5-bisphosphate and ADP-ribosylation factor-1. This protein localizes to the peripheral membrane and may be involved in cytoskeletal organization, cell cycle control, transcriptional regulation, and/or regulated secretion. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]'
Locus ID 5338

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.