Cathepsin K (CTSK) (NM_000396) Human 3' UTR Clone

CAT#: SC207804

3`UTR clone of cathepsin K (CTSK) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CTSK
• Synonyms: CTS02; CTSO; CTSO1; CTSO2; PKND; PYCD
• ACCN: NM_000396
• Insert Size: 609 bp
• Sequence Data:
  Insert Sequence

  >SC207804 3'UTR clone of NM_000396
  The sequence shown below is from the reference sequence of NM_000396. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAACGCCTGTGGCATTGCCAACCTGGCCAGCTTCCCCAAGATGTGACTCCAGCCAGCCAAATCCATCCT
  GCTCTTCCATTTCTTCCACGATGGTGCAGTGTAACGATGCACTTTGGAAGGGAGTTGGTGTGCTATTTTT
  GAAGCAGATGTGGTGATACTGAGATTGTCTGTTCAGTTTCCCCATTTGTTTGTGCTTCAAATGATCCTTC
  CTACTTTGCTTCTCTCCACCCATGACCTTTTTCACTGTGGCCATCAGGACTTTCCCTGACAGCTGTGTAC
  TCTTAGGCTAAGAGATGTGACTACAGCCTGCCCCTGACTGTGTTGTCCCAGGGCTGATGCTGTACAGGTA
  CAGGCTGGAGATTTTCACATAGGTTAGATTCTCATTCACGGGACTAGTTAGCTTTAAGCACCCTAGAGGA
  CTAGGGTAATCTGACTTCTCACTTCCTAAGTTCCCTTCTATATCCTCAAGGTAGAAATGTCTATGTTTTC
  TACTCCAATTCATAAATCTATTCATAAGTCTTTGGTACAAGTTTACATGATAAAAAGAAATGTGATTTGT
  CTTCCCTTCTTTGCACTTTTGAAATAAAGTATTTATCTCCTGTCTACAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000396.2
• Summary: 'The protein encoded by this gene is a lysosomal cysteine proteinase involved in bone remodeling and resorption. This protein, which is a member of the peptidase C1 protein family, is predominantly expressed in osteoclasts. However, the encoded protein is also expressed in a significant fraction of human breast cancers, where it could contribute to tumor invasiveness. Mutations in this gene are the cause of pycnodysostosis, an autosomal recessive disease characterized by osteosclerosis and short stature. [provided by RefSeq, Apr 2013]'
• Locus ID: 1513