Nicotinic Acetylcholine Receptor alpha 7 (CHRNA7) (NM_000746) Human 3' UTR Clone

CAT#: SC207827

3`UTR clone of cholinergic receptor nicotinic alpha 7 (CHRNA7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CHRNA7
• Synonyms: CHRNA7-2; NACHRA7
• ACCN: NM_000746
• Insert Size: 578
• Sequence Data:
  Insert Sequence

  >SC207827 3'UTR clone of NM_000746
  The sequence shown below is from the reference sequence of NM_000746. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGTGTCCAAAGACTTTGCGTAACCACGCCTGGTTCTGTACATGTGGAAAACTCACAGATGGGCAAGGCC
  TTTGGCTTGGCGAGATTTGGGGGTGCTAATCCAGGACAGCATTACACGCCACAACTCCAGTGTTCCCTTC
  TGGCTGTCAGTCGTGTTGCTTACGGTTTCTTTGTTACTTTAGGTAGTAGAATCTCAGCACTTTGTTTCAT
  ATTCTCAGATGGGCTGATAGATATCCTTGGCACATCCGTACCATCGGTCAGCAGGGCCACTGAGTAGTCA
  TTTTGCCCATTAGCCCACTGCCTGGAAAGCCCTTCGGAGAGCTCCCCATGGCTCCTCACCACCGAGACAG
  TTGGTTTTGCATGTCTGCATGAAGGTCTACCTGAAAATTCAACATTTGCTTTTTGCTTGTGTACAAACCC
  AGATTGAAGCTAAAATAAACCAGACTCACTAAATCCTTTCCAATAATTGACTGGTGGAAGGAAAACAAAA
  AACAAAAACTAAAAACCTCTTAGCTTTTCTGCAATTCAACTTTTTATTTTTATTTTTATTTCTATCAAAG
  ACGGTAGAGAGAAACAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_000746.3
• Summary: The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
• Locus ID: 1139