Nicotinic Acetylcholine Receptor alpha 7 (CHRNA7) (NM_000746) Human 3' UTR Clone

CAT#: SC207827

3`UTR clone of cholinergic receptor nicotinic alpha 7 (CHRNA7) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHRNA7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CHRNA7
Synonyms CHRNA7-2; NACHRA7
ACCN NM_000746
Insert Size 578
Sequence Data
>SC207827 3'UTR clone of NM_000746
The sequence shown below is from the reference sequence of NM_000746. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCGTGTCCAAAGACTTTGCGTAACCACGCCTGGTTCTGTACATGTGGAAAACTCACAGATGGGCAAGGCC
TTTGGCTTGGCGAGATTTGGGGGTGCTAATCCAGGACAGCATTACACGCCACAACTCCAGTGTTCCCTTC
TGGCTGTCAGTCGTGTTGCTTACGGTTTCTTTGTTACTTTAGGTAGTAGAATCTCAGCACTTTGTTTCAT
ATTCTCAGATGGGCTGATAGATATCCTTGGCACATCCGTACCATCGGTCAGCAGGGCCACTGAGTAGTCA
TTTTGCCCATTAGCCCACTGCCTGGAAAGCCCTTCGGAGAGCTCCCCATGGCTCCTCACCACCGAGACAG
TTGGTTTTGCATGTCTGCATGAAGGTCTACCTGAAAATTCAACATTTGCTTTTTGCTTGTGTACAAACCC
AGATTGAAGCTAAAATAAACCAGACTCACTAAATCCTTTCCAATAATTGACTGGTGGAAGGAAAACAAAA
AACAAAAACTAAAAACCTCTTAGCTTTTCTGCAATTCAACTTTTTATTTTTATTTTTATTTCTATCAAAG
ACGGTAGAGAGAAACAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000746.3
Summary The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Locus ID 1139

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.