EGLN2 (NM_053046) Human 3' UTR Clone

CAT#: SC207831

3`UTR clone of egl nine homolog 2 (C. elegans) (EGLN2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "EGLN2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EGLN2
Synonyms EIT-6; EIT6; HIF-PH1; HIFPH1; HPH-1; HPH-3; PHD1
ACCN NM_053046
Insert Size 580
Sequence Data
>SC207831 3'UTR clone of NM_053046
The sequence shown below is from the reference sequence of NM_053046. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAAGTACCTGTATCACAGCCGCCTACGCCCACCTAGTGGCCAGTCCCAGAGCCGCATGGCAGACAGCTT
AAATGACTTCAGGAGAGCCCTGGGCCTGTGCTGGCTGCTCCTTCCCTGCCACCGCTGCTGCTTCTGACTT
TGCCTCTGTCCTGCCTGGTGTGGAGGGCTCTGTCTGTTGCTGAGGACCAAGGAGGAGAAGAGACCTTTGC
TGCCCCATCATGGGGGCTGGGGTTGTCACCTGGACAGGGGGCAGCCGTGGAGGCCACCGTTACCAACTGA
AGCTGGGGGCCTGGGTCCTACCCTGTCTGGTCATGACCCCATTAGGTATGGAGAGCTGGGAGGAGGCATT
GTCACTTCCCACCAGGATGCAGGACTTGGGGTTGAGGTGAGTCATGGCCTCTTGCTGGCAATGGGGTGGG
AGGAGTACCCCCAAGTCCTCTCACTCCTCCAGCCTGGAATGTGAAGTGACTCCCCAACCCCTTTGGCCAT
GGCAGGCACCTTTTGGACTGGGCTGCCACTGCTTGGGCAGAGTAAAAGGTGCCAGGAGGAGCATGGGTGT
GGAAGTCCTGTCAGCCAAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_053046.2
Summary The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
Locus ID 112398

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.