GPM6B (NM_005278) Human 3' UTR Clone

CAT#: SC207835

3`UTR clone of glycoprotein M6B (GPM6B) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GPM6B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GPM6B
Synonyms M6B
ACCN NM_005278
Insert Size 591
Sequence Data
>SC207835 3'UTR clone of NM_005278
The sequence shown below is from the reference sequence of NM_005278. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCGGGAAGATTGCTGCACTAAATTCTAAATTGCATAAGGAGTTTTAGAGAGCTATGCTCTGTAGCATGAA
ATATCACTGACACTCCAGACTAAAGCAGAGTCTAGGTTTCTGCAATTTTGTTACAGTAATTTGTAAATAG
CTTTAGTAAACTCACCTTGCATGGTAGATTAATAAGATGACTTACTGTACATGAATTACACAATAATGAG
ATCTGGTGGCTATTTCCACATTTTGAAAAGGATTCAGTTATTTACTGACAGTGGTGAGCATCCTTTTTAA
AATAATGTTCTCATACTTAAACATTAGAGAGCAGTATCTTTAAATGAATTATTAACACTTTGGAATACTT
ACATTTTCTGTTATTTTTGATTGCCTGATAACCAGTTTCAATGATGAAAATGAAAACAAGTGCTGAAGAT
GAAATGGAAGAGAACCGTTTTAATCTGGATTTTGTTTTGTCACACCTGGAAAATACTTTGCAAATATGTT
CTAAATTGAAAACAATTTTTTTATGATCACATGGTTCACTACCAAATGACCCTCAAATAAGCCAGATGAA
AATTTGAAGAAAAAGGTCACCCAGTTCTCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005278.3
Summary This gene encodes a membrane glycoprotein that belongs to the proteolipid protein family. Proteolipid protein family members are expressed in most brain regions and are thought to be involved in cellular housekeeping functions such as membrane trafficking and cell-to-cell communication. This protein may also be involved in osteoblast differentiation. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes Y and 22. [provided by RefSeq, Jan 2016]
Locus ID 2824

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.