UBE2I (NM_194261) Human 3' UTR Clone

CAT#: SC207900

3`UTR clone of ubiquitin-conjugating enzyme E2I (UBC9 homolog yeast) (UBE2I) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "UBE2I"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol UBE2I
Synonyms C358B7.1; P18; UBC9
ACCN NM_194261
Insert Size 623 bp
Sequence Data
>SC207900 3'UTR clone of NM_194261
The sequence shown below is from the reference sequence of NM_194261. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAGCCAAGAAGTTTGCGCCCTCATAAGCAGCGACCTTGTGGCATCGTCAAAAGGAAGGGATTGGTTTGG
CAAGAACTTGTTTACAACATTTTTGCAAATCTAAAGTTGCTCCATACAATGACTAGTCACCTGGGGGGGT
TGGGCGGGCGCCATCTTCCATTGCCGCCGCGGGTGTGCGGTCTCGATTCGCTGAATTGCCCGTTTCCATA
CAGGGTCTCTTCCTTCGGTCTTTTGTATTTTTGATTGTTATGTAAAACTCGCTTTTATTTTAATATTGAT
GTCAGTATTTCAACTGCTGTAAAATTATAAACTTTTATACTTGGGTAAGTCCCCCAGGGGCGAGTTCCTC
GCTCTGGGATGCAGGCATGCTTCTCACCGTGCAGAGCTGCACTTGGCCTCAGCTGGCTGTATGGAAATGC
ACCCTCCCTCCTGCCGCTCCTCTCTAGAACCTTCTAGAACCTGGGCTGTGCTGCTTTTGAGCCTCAGACC
CCAGGTCAGCATCTCGGTTCTGCGCCACTTCCTTTGTGTTTATATGGCGTTTTGTCTGTGTTGCTGTTTA
GAGTAAATAAACTGTTTATATAAAGGTTTTGGTTGCATTATTATCATTGAAAGTGAGAGGAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_194261.1
Summary 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 7329

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.