UBE2I (NM_194260) Human 3' UTR Clone

CAT#: SC207902

3`UTR clone of ubiquitin-conjugating enzyme E2I (UBC9 homolog yeast) (UBE2I) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UBE2I
• Synonyms: C358B7.1; P18; UBC9
• ACCN: NM_194260
• Insert Size: 623 bp
• Sequence Data:
  Insert Sequence

  >SC207902 3'UTR clone of NM_194260
  The sequence shown below is from the reference sequence of NM_194260. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGCCAAGAAGTTTGCGCCCTCATAAGCAGCGACCTTGTGGCATCGTCAAAAGGAAGGGATTGGTTTGG
  CAAGAACTTGTTTACAACATTTTTGCAAATCTAAAGTTGCTCCATACAATGACTAGTCACCTGGGGGGGT
  TGGGCGGGCGCCATCTTCCATTGCCGCCGCGGGTGTGCGGTCTCGATTCGCTGAATTGCCCGTTTCCATA
  CAGGGTCTCTTCCTTCGGTCTTTTGTATTTTTGATTGTTATGTAAAACTCGCTTTTATTTTAATATTGAT
  GTCAGTATTTCAACTGCTGTAAAATTATAAACTTTTATACTTGGGTAAGTCCCCCAGGGGCGAGTTCCTC
  GCTCTGGGATGCAGGCATGCTTCTCACCGTGCAGAGCTGCACTTGGCCTCAGCTGGCTGTATGGAAATGC
  ACCCTCCCTCCTGCCGCTCCTCTCTAGAACCTTCTAGAACCTGGGCTGTGCTGCTTTTGAGCCTCAGACC
  CCAGGTCAGCATCTCGGTTCTGCGCCACTTCCTTTGTGTTTATATGGCGTTTTGTCTGTGTTGCTGTTTA
  GAGTAAATAAACTGTTTATATAAAGGTTTTGGTTGCATTATTATCATTGAAAGTGAGAGGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_194260.1
• Summary: 'The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 7329