NT5C3 (NT5C3A) (NM_001002010) Human 3' UTR Clone

CAT#: SC207947

3`UTR clone of 5'-nucleotidase cytosolic III (NT5C3) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NT5C3A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NT5C3A
Synonyms cN-III; hUMP1; NT5C3; p36; P5 N-1; P5N-1; PN-I; POMP; PSN1; UMPH; UMPH1
ACCN NM_001002010
Insert Size 633
Sequence Data
>SC207947 3'UTR clone of NM_001002010
The sequence shown below is from the reference sequence of NM_001002010. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAATCATTAGAAGTAGCCAACTCTATTTTACAGAAGATTCTATAAACAAGCATTCTCCAAGAAGACCTCT
CTCCTGTGGGTGCAATTGAACTGTTCATCCGTTCATCTTGCTGAGAGACTTATTTATAATATATCCTTAC
TCTCGAAGTGTTCCCTTTGTATAACTGAAGTATTTTCAGATATGGTGAATGCATTGACTGGAAGCTCCTT
TTCTCCACCTCTCTCAACACACTCCTCACCGTATCTTTTAACCCATTTAAAAAAAAAAAAAAGCTAAAAT
TAGAAAAATAACTCCCTACTTTTCCAAAGTGAATTTTGTAGTTTAATGTTATCATGCAGCTTTTGAGGAG
TCTTTTACACTGGGAAAGTTTGTAGAAATTTTAAAATAAGTTTTATGAAATGGTGAAATAATATGCATGA
TTTTAAGTATTGCCATTTTTGTAATTTGGGTTATTATGCTGATGGTATCACCATCTCTTGAAATTGTGTT
AGGTTTGGTTATTTTGTCTGGGGAAAAAATATTTACTGGAAAAGACTAGCAGTTAGTGTTGGAAAAACCT
GGTGGTGTTTACAATGTTGCTAATCATTACAAAACATTCTATATTGAAGCACTGATAATAAATATGAAAT
GCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002010.1
Summary This gene encodes a member of the 5'-nucleotidase family of enzymes that catalyze the dephosphorylation of nucleoside 5'-monophosphates. The encoded protein is the type 1 isozyme of pyrimidine 5' nucleotidase and catalyzes the dephosphorylation of pyrimidine 5' monophosphates. Mutations in this gene are a cause of hemolytic anemia due to uridine 5-prime monophosphate hydrolase deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and pseudogenes of this gene are located on the long arm of chromosomes 3 and 4. [provided by RefSeq, Mar 2012]
Locus ID 51251

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.