PROX1 (NM_002763) Human 3' UTR Clone

CAT#: SC207956

3`UTR clone of prospero homeobox 1 (PROX1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PROX1
• Synonyms: prospero-related homeobox 1; prospero homeobox 1
• ACCN: NM_002763
• Insert Size: 587 bp
• Sequence Data:
  Insert Sequence

  >SC207956 3'UTR clone of NM_002763
  The sequence shown below is from the reference sequence of NM_002763. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAACTGCCTACAAGAGCTGCTTCATGAGTAGAAATTTCAACAACTCTTTTTGAATGTATGAAGAGTAGCA
  GTCCCCTTTGGATGTCCAAGTTATATGTGTCTAGATTTTGATTTCATATATATGTGTATGGGAGGCATGG
  ATATGTTATGAAATCAGCTGGTAATTCCTCCTCATCACGTTTCTCTCATTTTCTTTTGTTTTCCATTGCA
  AGGGGATGGTTGTTTTCTTTCTGCCTTTAGTTTGCTTTTGCCCAAGGCCCTTAACATTTGGACACTTAAA
  ATAGGGTTAATTTTCAGGGAAAAAGAATGTTGGCGTGTGTAAAGTCTCTATTAGCAATGAAGGGAATTTG
  TTAACGATGCATCCACTTGATTGATGACTTATTGCAAATGGCGGTTGGCTGAGGAAAACCCATGACACAG
  CACAACTCTACAGACAGTGATGTGTCTCTTGTTTCTACTGCTAAGAAGGTCTGAAAATTTAATGAAACCA
  CTTCATACATTTAAGTATTTTGTTTGGTTTGAACTCAATCAGTAGCTTTTCCTTACATGTTTAAAAATAA
  TTCCAATGACAGATGAGCAGCTCACTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002763.3
• Summary: 'The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]'
• Locus ID: 5629