FUCA2 (NM_032020) Human 3' UTR Clone

CAT#: SC207967

3`UTR clone of fucosidase alpha-L- 2 plasma (FUCA2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FUCA2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FUCA2
Synonyms dJ20N2.5
ACCN NM_032020
Insert Size 612 bp
Sequence Data
>SC207967 3'UTR clone of NM_032020
The sequence shown below is from the reference sequence of NM_032020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCTAGCCCTGACTAATGTGATCTAAAGTGCAGCAGAGTGGCTGATGCTGCAAGTTATGTCTAAGGCTAG
GAACTATCAGGTGTCTATAATTGTAGCACATGGAGAAAGCAAATGTAAAACTGGATAAGAAAATTATTTT
GGCAGTTCAGCCCTTTCCCTTTTTCCCACTAAATTTTTTCTTAAATTACCCATGTAACCATTTTAACTCT
CCAGTGCACTTTGCCATTAAAGTCTCTTCACATTGATTTGTTTCCATGTGTGACTCAGAGGTGAGAATTT
TTTCACATTATAGTAGCAAGGAATTGGTGGTATTATGGACCGAACTGAAAATTTTATGTTGAAGCCATAT
CCCCCATGATTATATAGTTATGCATCACTTAATATGGGGATATTTTCTGGGAAATGCATTGCTAGTCAAT
TTTTTTTTGTGCCAACATCATAGAGTGTATTTACAAAATCCTAGATGGCATAGCCTACTACACACCTAAT
GTGTATGGTATAGACTGTTGCTCCTAGGCTACAGACATATACAGCATGTTACTGAATACTGTAGGCAATA
GTAACAGTGGTATTTGTATATCGAAACATATGGAAACATAGAGAAGGTACAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_032020.3
Summary 'This gene encodes a plasma alpha-L-fucosidase, which represents 10-20% of the total cellular fucosidase activity. The protein is a member of the glycosyl hydrolase 29 family, and catalyzes the hydrolysis of the alpha-1,6-linked fucose joined to the reducing-end N-acetylglucosamine of the carbohydrate moieties of glycoproteins. This enzyme is essential for Helicobacter pylori adhesion to human gastric cancer cells. [provided by RefSeq, Aug 2010]'
Locus ID 2519

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.