GGT7 (NM_178026) Human 3' UTR Clone

CAT#: SC208029

3`UTR clone of gamma-glutamyltransferase 7 (GGT7) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GGT7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GGT7
Synonyms D20S101; GGT4; GGTL3; GGTL5
ACCN NM_178026
Insert Size 597 bp
Sequence Data
>SC208029 3'UTR clone of NM_178026
The sequence shown below is from the reference sequence of NM_178026. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGGAGCCACCATCCTGTAGAGCAGCGGGGTGGGGCGGGGTCTCTGCTCCCCCACTTTGCATGTTCCCAG
AGTCCCTCCTTCTCCCAGGTTTGGTCTCAGGGGGACCCCAGGGATGCCCCAGATCAGGGGCCAGAGGGGA
TGCTTAGCAAACCCAATCCCAGAGTAACTGGAAAATTCTCCATCAGGAGGCCTGTGGTGGTGGTGGTGGT
GGTGGTGGTGGTGGTGGTGGTGGTGAGTGTCAGCATCTACAGTACAGCCAGGCAGGCAGGACCTTGAGGA
ATCAGACTATCTGTCTGTGTGTCACCTCTCCTCCTTCAGCCATGCTGGCCCCGAGCTTAGGGATGTGCTT
GCAAACCCTTCTCAAGGGTCTCACAACCCCAACATCTTCAGACTGGCCTGACCTGGGCCTTGTCTTCCAG
TTCCTTTCTCCCATTCCCAGCCTCATTTCTTAAATGACTAGGAATTTTTTAATGGACCATCATAGGGAGG
GGGTGCTCCTCTTTTCCCACCAGGTTGAGGTGGGGGCCTTGCATCGGGGGTCCCCAGGGTATGGGGTAGG
GGTGGGGGTGGGCACCAGCTCAGGGGCTTCCATTTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_178026.2
Summary 'This gene is a member of a gene family that encodes enzymes involved in both the metabolism of glutathione and in the transpeptidation of amino acids. Changes in the activity of gamma-glutamyltransferase may signal preneoplastic or toxic conditions in the liver or kidney. The protein encoded by this gene consists of a heavy and a light chain, and it can interact with CT120, a plasma membrane-associated protein that is possibly involved in lung carcinogenesis. [provided by RefSeq, Jul 2008]'
Locus ID 2686

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.