CD89 (FCAR) (NM_133273) Human 3' UTR Clone

CAT#: SC208068

3`UTR clone of Fc fragment of IgA receptor for (FCAR) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FCAR"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FCAR
Synonyms CD89; CTB-61M7.2; FcalphaRI
ACCN NM_133273
Insert Size 653 bp
Sequence Data
>SC208068 3'UTR clone of NM_133273
The sequence shown below is from the reference sequence of NM_133273. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCCAGGATTGACCTTTGCACGAACACCAAGTGTCTGCAAGTAAACACCTGGAGGTGAAGGCAGAGAGGA
GCCAGGACTGTGGAGTCCGACAAAGCTACTTGAAGGACACAAGAGAGAAAAGCTCACTAAGAAGCTTGAA
TCTACTTTTTTTTTTTTTTGAGACAGAGTCTGGCTCTGTCACCCAGGCTGGAGTGCAGTGGAGCAATCTC
GGCTCATTGAACCTCTTGGGTTCAAGTGATTCTTGTGCCTCAGCCTCCCAAGTAGCTGGAATTACAGGCA
CATACCACTGCACCCAGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTTCACTGTGTTGGCCAGGCTGG
TCTCGAACTCCTGACCTCAGGTGATCCACCCACCTTGGCCTCCCAAAGTGCTGAGATTATAGGCATGAGC
CACCACGCCTGGCCAGATGCATGTTCAAACCAATCAAATGGTGTTTTCTTATGCAGGACTGATCGATTTG
CACCCACCTTTCTGCACATAAGTTATGGTTTTCCATCTTATCTGTCTTCTGATTTTTTATATCCTGTTTA
ATTTCTTCCTTCATTGTTCTTCTCTTTTTTTATTTATTTTATTTATTTTTATTTTTATTTTTATTTGAGA
CAGAGTCTCACTCTGTTGCCCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_133273.2
Summary 'This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 2204

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.