P Glycoprotein (ABCB1) (NM_000927) Human 3' UTR Clone

CAT#: SC208086

3`UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 1 (ABCB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCB1
• Synonyms: ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1
• ACCN: NM_000927
• Insert Size: 615 bp
• Sequence Data:
  Insert Sequence

  >SC208086 3'UTR clone of NM_000927
  The sequence shown below is from the reference sequence of NM_000927. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAACAAAGCGCCAGTGAACTCTGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGATATGAC
  ATTTATTCAAAGTTAAAAGCAAACACTTACAGAATTATGAAGAGGTATCTGTTTAACATTTCCTCAGTCA
  AGTTCAGAGTCTTCAGAGACTTCGTAATTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAATC
  ATAGTTTAAACTGCATTATAAATTTTATAACAGAATTAAAGTAGATTTTAAAAGATAAAATGTGTAATTT
  TGTTTATATTTTCCCATTTGGACTGTAACTGACTGCCTTGCTAAAAGATTATAGAAGTAGCAAAAAGTAT
  TGAAATGTTTGCATAAAGTGTCTATAATAAAACTAAACTTTCATGTGACTGGAGTCATCTTGTCCAAACT
  GCCTGTGAATATATCTTCTCTCAATTGGAATATTGTAGATAACTTCTGCTTTAAAAAAGTTTTCTTTAAA
  TATACCTACTCATTTTTGTGGGAATGGTTAAGCAGTTTAAATAATTCCTGTTGTATATGTCTATTCACAT
  TGGGTCTTACAGAACCATCTGGCTTCATTCTTCTTGGACTTGATCCTGCTGATTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000927.3
• Summary: 'The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is an ATP-dependent drug efflux pump for xenobiotic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. Mutations in this gene are associated with colchicine resistance and Inflammatory bowel disease 13. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Feb 2017]'
• Locus ID: 5243