AP3S1 (NM_001284) Human 3' UTR Clone

CAT#: SC208134

3`UTR clone of adaptor-related protein complex 3 sigma 1 subunit (AP3S1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AP3S1
• Synonyms: CLAPS3; Sigma3A
• ACCN: NM_001284
• Insert Size: 588 bp
• Sequence Data:
  Insert Sequence

  >SC208134 3'UTR clone of NM_001284
  The sequence shown below is from the reference sequence of NM_001284. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCAAACCTGCCCTCTTTTAAATAAAAATGTAAAAAGGCCACTCCCAGGTAAAATCCAGGGGGAAGAGT
  CATCTAAGTTTACCATGCAGTTGTTTACCAAAAATAGAGGAGGAGAGTCTTAACTTTTGCTCTTGGATTT
  AAGTCAAGGTACTGTATAGAAGTTGTGTAAAATCAGTATGAAAGTTCAATGTTGCTGTTCTTGCTCAGTG
  ATTTTAAAGAAATTGAGTAGTTCCTATGTGATTTTTTTTTTTCTTTTCTAAACTGCATTCCTGTGCCCAC
  CTACGGCATGCCTCTATGTATTGGCTACTACAGTGTTTTAAAAAGTGTTTCAGATATTTCTCTAATTATG
  TACAACCTAAAATGTTGGTGTTTTGTATGGATCACAAGTGCAGCATTCCTTAATTCCTTCTGCTATATGT
  CACACAGTTGTTATTTGGAGAACCAAGTATGTATTGCATGAAAACATTATGACTTTTTTCTCTTAGTTTA
  AATAAACTCCAAGGTAACTGGACTTCTAAAGCACCTTTCTGTTTGCCTGATATCTACTTTAGCAATAATT
  TTTTTTACAACCCTCTGACTCAACAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001284.2
• Summary: 'This gene encodes a subunit of the AP3 adaptor complex. This complex functions in the formation of subcellular vesicles budded from the Golgi body. Several related pseudogenes of this gene have been found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]'
• Locus ID: 1176