CPT2 (NM_000098) Human 3' UTR Clone

CAT#: SC208180

3`UTR clone of carnitine palmitoyltransferase 2 (CPT2) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CPT2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CPT2
Synonyms CPT1; CPTASE; IIAE4
ACCN NM_000098
Insert Size 615 bp
Sequence Data
>SC208180 3'UTR clone of NM_000098
The sequence shown below is from the reference sequence of NM_000098. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGTTTGATGCCTTAGAAGGCAAATCCATCAAAAGTTAACTTCTGGGCAGATGAAAAGCTACCATCACTTC
CTCATCATGAAAACTGGGAGGCCGGGCATGGTGGCTCATGCCTGTAATCCCAGCATTTTGAGAGGCTGAG
GCGGGTGGATCACTTGAGGTCAGGAGTTTGAGACCAACCTGGCCAACATGGTGAAACCTTGTCTCTACTA
AAAATACAAAAATTAGCTGGGTGTGGTGGCATGTGCCTATAATCCCAGCTACTTGGGAGGTTGAAGCAGA
ATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATCACACCACTGCACTCCGGCCTGGGCGAC
AGAGCGAGACTGTCTCAAAAAAACAAAAAAGAAAAAAAAACTGGGGCCTGTGTAGCCAGTGGGTGCTATT
CTGTGAAACTAATCATAAGCTGCCTAGGCAGCCAGCTACAGGCTTGAGCTTTAAATTCATGGTTTTAAAG
CTAAACGTAATTTCCACTTGGGACTAGATCACAACTGAAGATAACAAGAGATTTAAGTTTTAAGGGCATT
TAATCAGGAGGAAAGGTTTGGAAAACTAACTCAGGTGTATTTATTGTTTAAGCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000098.2
Summary 'The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]'
Locus ID 1376

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.