GJA4 (NM_002060) Human 3' UTR Clone

CAT#: SC208203

3`UTR clone of gap junction protein alpha 4 37kDa (GJA4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GJA4
• Synonyms: CX37
• ACCN: NM_002060
• Insert Size: 554 bp
• Sequence Data:
  Insert Sequence

  >SC208203 3'UTR clone of NM_002060
  The sequence shown below is from the reference sequence of NM_002060. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCTCTGCTTCTAAGAAGCAGTATGTATAGAGGCCTGTGGCTTATGTCACCCAACAGAGGGGTCCTGAG
  AAGTCTGGCTGCCTGGGATGCCCCCTGCCCCCTCCTGGAAGGCTCTGCAGAGATGACTGGGCTGGGGAAG
  CAGGTGCTTGCTGGCCATGGAGCCTCATTGCAAGTTGTTCTTGAACACCTGAGGCCTTCCTGGTGCCCAC
  CAGGCACTACGGCTTCCTCTCCAGAATGTGGCTTTGCCTGAGCACAGACAGAGTCAGCATGGAATGCTCT
  TGGCCAAGGGTACTGGGGGCCCTCTGGCCTTTTGCAGCTGATCCAGAGGAACCCAGAGCCAACTTACCCC
  AACCTCACCCTATGGAACAGTCACCTGTGCGCAGGTTGTCCTCAAACCCTCTCCTCACAGGAAAAGGCGG
  ATTGAGGCTGCTGGGTCAGCCTTGATCGCACAGACAGAGCTTGTGCCGGATTTGGCCCTGTCAAGGGGAC
  TGGTGCCTTGTTTTCATCACTCCTTCCTAGTTCTACTGTTCAAGCTTCTGAAATAAACAGGACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002060.2
• Summary: 'This gene encodes a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. Mutations in this gene have been associated with atherosclerosis and a higher risk of myocardial infarction. [provided by RefSeq, Jul 2008]'
• Locus ID: 2701