Kininogen 1 (KNG1) (NM_000893) Human 3' UTR Clone

CAT#: SC208240

3`UTR clone of kininogen 1 (KNG1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KNG1
• Synonyms: BDK; BK; HMWK; KNG
• ACCN: NM_000893
• Insert Size: 628 bp
• Sequence Data:
  Insert Sequence

  >SC208240 3'UTR clone of NM_000893
  The sequence shown below is from the reference sequence of NM_000893. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGCCAGCATCTGAGAGGGAGGTCTCTTGACCAATGGGCAGAATCTTCACTCCAGGCACATAGCCCCAA
  CCACCTCTGCCAGCAACCTTGAGAGGAAGGACAAGAAGAAAGATGGGATAGAATTTAAATAGAGAAGAAT
  GCCATTTTATCACTCTGCCTCTGGGTGAAATAAAGATCAGTCTTGATGTTCTAACTCTAATTCACAGTGG
  TCTCCTTTCAGCCCTACCCATTCTGCAGCAAATTCCAGCTGGTCAGAGAGTCAGTGCTGTGGCTCTGCCA
  TGGAGGCTCATAACCCAACACTGGAACATTCCCTAGCCAAGGCAGAAGTCCTTAGGCGGGACTTCCTTAC
  CACCACGGGTGCTAAAAGAAGAGTTAGTAGGTCATGCTTCTACCAGTAATCTAAGGACTCTCTCCTTCTC
  TTCTTCCTCTTTCTCCAGATTTCCAAGCCTTAGCTAAGAGTAATTTGGCTTGTTTAGTATTGTTTTCTTA
  TGGTCCAGTTAATTACCAAAAATATTTTTAAAATCATCTCTGTTAATAGAATGTCTACCAACTTCTCACT
  ATCAGAAAATACTCAACCTCCAAACAATTTGAAATTATCTTTCTGATCCAGGTAAAGAAGCAAATTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000893.3
• Summary: 'This gene uses alternative splicing to generate two different proteins- high molecular weight kininogen (HMWK) and low molecular weight kininogen (LMWK). HMWK is essential for blood coagulation and assembly of the kallikrein-kinin system. Also, bradykinin, a peptide causing numerous physiological effects, is released from HMWK. Bradykinin also functions as an antimicrobial peptide with antibacterial and antifungal activity. In contrast to HMWK, LMWK is not involved in blood coagulation. Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) reduces or depletes angiotensin converting enzyme 2 (ACE2), which results in an increase in levels of des-Arg(9)-bradykinin, a bioactive metabolite of bradykinin that is associated with lung injury and inflammation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2020]'
• Locus ID: 3827