PGEA1 (CBY1) (NM_015373) Human 3' UTR Clone

CAT#: SC208289

3`UTR clone of chibby homolog 1 (Drosophila) (CBY1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CBY1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CBY1
Synonyms arb1; C22orf2; CBY; Chibby1; HS508I15A; PGEA1; PIGEA-14; PIGEA14
ACCN NM_015373
Insert Size 630
Sequence Data
>SC208289 3'UTR clone of NM_015373
The sequence shown below is from the reference sequence of NM_015373. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGAAGGAACTGGATGAACTGAGGATCAGCCGGAAGAGAAAATGAAGACCCCAGAGACATTTATTGGGG
AGTAGGATGTGGCTGAGTGCTTTTTTTTTGGCCAGACTAGCGGATTCAGTCCTGGAAGAGAGTATCATAT
AATGAGACCCACAGGCACTGGCACCCTTGGGTTGGCAATAGAAGGTGACATGGAATGGAGAAAACCAAGA
TTCCAGATGGGGATAGTAACTAGAAGGTGCTTCAGATGCACTGCCTGCGGGTGCCAGTCTGAAAACCAGA
CCGCACAGAGGCCTGGGGCTGCTGATGAGCTTTTTGGTGCTCTCCACACACAAGCTCGCAAACACACATG
TCCCAGAATAGCTCTGTTGGGTTGTGTTGGGAGAAGCGGCTGGAGTTCATTCTCTCACCCCCTTATGTTG
GTGTTTGGCGTGTGACAGCAGTTCTACAGAGCTCTGTGTTGGGGTCATGGATGAGCGGCTCTCTTGGCTC
TTAAAGGCAGGCCTCTCTCTTCTTGCCTTTAAAGAATCCTCCTTCCTCACACCTGGCCTCCTCTGGCTTC
AGCTTCTCAGCAGCAAGCACCAGCCTTCCACAACAACACTATATTTTTATGCTACTTTCCTGTTTGCACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015373.3
Summary Beta-catenin is a transcriptional activator and oncoprotein involved in the development of several cancers. The protein encoded by this gene interacts directly with the C-terminal region of beta-catenin, inhibiting oncogenic beta-catenin-mediated transcriptional activation by competing with transcription factors for binding to beta-catenin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 25776

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.