DARS (NM_001349) Human 3' UTR Clone

CAT#: SC208300

3`UTR clone of aspartyl-tRNA synthetase (DARS) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DARS"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DARS
Synonyms aspRS; HBSL
ACCN NM_001349
Insert Size 636 bp
Sequence Data
>SC208300 3'UTR clone of NM_001349
The sequence shown below is from the reference sequence of NM_001349. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATCCCAAACGACTCACTCCTTAAATTCACACTTTGCCACTTAACTCCAGTGTGGATGACAGAGCGAGACC
CTGCCTCAAAAAAAAAAAAAAAAAAAGAAAGCCACACTTATTCTTTTCAGTAACCTGCTAGTGCACAGGC
TGTACTTTAGGTACTTAAAATATGCACTAGAATAAATTTGCAAGGCCCTAAAATATCACTGTTATTTTTG
GAGTAATTCAGTATAGGTTCGTTTAAAAGAGATTTTTATAACTTCAGACATGCATCAGTAGGAAATAACT
TGAGAAATTCATATGGTTATGTTACAAATTCATATTCTGTTACTACAGTAAACGTTAAGAGTTTTAAACA
GTTAAGATTGTACAATTTTTCTTCTTTTCTATATTACAAGGGCCCCAGTGTTAATGTCTTAGATTTTCAG
TATTTGAACTTATTTTTTTAAATTCTGTCATTGAGATAAGAATAATTCAGGTAGCATCTGAAATTTTAAT
GAATGTATAATTGGCATATCATGGAAAATTAACCAGAAAGTATCAGTTCTTAAAAGTTATGCCTAGAAAT
TATGTAAAGCTAAACTACTGGTTAGAAAGTATTCAGTGTAATATTGTATTAATTTGTTAAATTCTAAACT
TGAATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001349.2
Summary 'This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]'
Locus ID 1615

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.