CD163 (NM_004244) Human 3' UTR Clone

CAT#: SC208301

3`UTR clone of CD163 molecule (CD163) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD163
• Synonyms: M130; MM130; SCARI1
• ACCN: NM_004244
• Insert Size: 627
• Sequence Data:
  Insert Sequence

  >SC208301 3'UTR clone of NM_004244
  The sequence shown below is from the reference sequence of NM_004244. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATTCTGAGCCACACTGAAAAGGAAAATGGGAATTTATAACCCAGTGAGTTCAGCCTTTAAGATACCTT
  GATGAAGACCTGGACTATTGAATGGAGCAGAAATTCACCTCTCTCACTGACTATTACAGTTGCATTTTTA
  TGGAGTTCTTCTTCTCCTAGGATTCCTAAGACTGCTGCTGAATTTATAAAAATTAAGTTTGTGAATGTGA
  CTACTTAGTGGTGTATATGAGACTTTCAAGGGAATTAAATAAATAAATAAGAATGTTATTGATTTGAGTT
  TGCTTTAATTACTTGTCCTTAATTCTATTAATTTCTAAATGGGCTTCCTAATTTTTTGTAGAGTTTCCTA
  GATGTATTATAATGTGTTTTATTTGACAGTGTTTCAATTTGCATATACAGTACTGTATATTTTTTCTTAT
  TTGGTTTGAATAATTTTCCTATTACCAAATAAAAATAAATTTATTTTTACTTTAGTTTTTCTAAGACAGG
  AAAAGTTAATGATATTGAAGGGTCTGTAAATAATATATGGCTAACTTTATAAGGCATGACTCACAACGAT
  TCTTTAACTGCTTTTTGTTACTGTAATTCTGTTCACTAGAATAAAATGCAGAGCCACACCTGGTGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004244.4
• Summary: The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
• Locus ID: 9332