ATP6AP1 (NM_001183) Human 3' UTR Clone

CAT#: SC208330

3`UTR clone of ATPase H+ transporting lysosomal accessory protein 1 (ATP6AP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6AP1
• Synonyms: 16A; Ac45; ATP6IP1; ATP6S1; CF2; VATPS1; XAP-3; XAP3
• ACCN: NM_001183
• Insert Size: 616 bp
• Sequence Data:
  Insert Sequence

  >SC208330 3'UTR clone of NM_001183
  The sequence shown below is from the reference sequence of NM_001183. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGCTTGGCGCGCC
  
  TTGACCCAGATTGTGTGACCCTGTGCCAGTGGGGGGGTTGAGGGTGGGACGGTGTCCGTGTTGTTGCTTT
  CCCACCCTGCAGCGCACTGGACTGAAGAGCTTCCCTCTTCCTACTGCAGCATGAACTGCAAGCTCCCCTC
  AGCCCATCTTGCTCCCTCTTCAGCCCGCTGAGGAGCTTTCTTGGGCTGCCCCCATCTCTCCCAACAAGGT
  GTACATATTCTGCGTAGATGCTAGACCAACCAGCTTCCCAGGGTTCGTCGCTGTGAGGCGTAAGGGACAT
  GAATTCTAGGGTCTCCTTTCTCCTTATTTATTCTTGTGGCTACATCATCCCTGGCTGTGGATAGTGCTTT
  TGTGTAGCAAATGCTCCCTCCTTAAGGTTATAGGGCTCCCTGAGTTTGGGAGTGTGGAAGTACTACTTAA
  CTGTCTGTCCTGCTTGGCTGTCGTTATCGTTTTCTGGTGATGTTGTGCTAACAATAAGAAGTACACGGGT
  TTATTTCTGTGGCCTGAGAAGGAAGGGACCTCCACGACAGGTGGGCTGGGTGCGATCGCCGGCTGTTTGG
  CATGTTCCCACCGGGAGTGCCGGGCAGGAGCATGGGGTGCTTGGTTGTTTCCTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: AscI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001183.4
• Summary: 'This gene encodes a component of a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Vacuolar ATPase (V-ATPase) is comprised of a cytosolic V1 (site of the ATP catalytic site) and a transmembrane V0 domain. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. The encoded protein of this gene may assist in the V-ATPase-mediated acidification of neuroendocrine secretory granules. This protein may also play a role in early development. [provided by RefSeq, Aug 2013]'
• Locus ID: 537