AMPK gamma 1 (PRKAG1) (NM_212461) Human 3' UTR Clone

CAT#: SC208404

3`UTR clone of protein kinase AMP-activated gamma 1 non-catalytic subunit (PRKAG1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PRKAG1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PRKAG1
Synonyms AMPKG; MGC8666
ACCN NM_212461
Insert Size 654 bp
Sequence Data
>SC208404 3'UTR clone of NM_212461
The sequence shown below is from the reference sequence of NM_212461. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTCACAGGTGGAGAGAAGAAGCCCTGAGCTGGGGGAAGGGGTCATGCAGCACCAGGGGATATGCCCAAC
TCACTGCCTGCTGGAAGCTCTGTGGGAATCAGATGAAACTTGAGGGAATTGTGACTCTGTTCCCTGTTCA
GGGTCCCCTGCCCTTCTATCTGGGAGCTAGGGAAGGTATGGGGGAGGAAAGAGAATGGATTTATAGCTAC
CCTTACCCTCACACATACACTTGAAAAAACTTTCAGCCTAGCCAGTTCTAGCCCCTGTCCTCTTAGATAT
ATCCCCCTTTCTGGGTGAACTATAGGCTCTGTGCCTCTCAGACAAATTCTGATCTCTAAGAGATCCCCAG
ACCTCACTTGCCTCTGCCTCCATCTTGGCCCTGATTCAACCCTAAGATAATAGCACAACAAAATTCTTCA
TAAAGATATTTTTATTCACCTGTTCCGTGCTATATGGAGGAGGCCAAGTCCATTTAGTGACATTTCTTCC
CATAATGTGAGTGGGGAGGATTGTGGGGAGGAGGGGCTTTGGGTTCCTGTGTTTGTGCATATGAAGGGAG
ATGGGGGTTAGGTGGAGGAGGAGAGCAGCGTGGTTAGCTAAGGTTATTGCTTTTTGTGGCAAATCTAATT
AAATGACAGGAATCTCTTCACGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_212461.1
Summary 'The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]'
Locus ID 5571

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.