AMPK gamma 1 (PRKAG1) (NM_212461) Human 3' UTR Clone

CAT#: SC208404

3`UTR clone of protein kinase AMP-activated gamma 1 non-catalytic subunit (PRKAG1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRKAG1
• Synonyms: AMPKG; MGC8666
• ACCN: NM_212461
• Insert Size: 654 bp
• Sequence Data:
  Insert Sequence

  >SC208404 3'UTR clone of NM_212461
  The sequence shown below is from the reference sequence of NM_212461. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTCACAGGTGGAGAGAAGAAGCCCTGAGCTGGGGGAAGGGGTCATGCAGCACCAGGGGATATGCCCAAC
  TCACTGCCTGCTGGAAGCTCTGTGGGAATCAGATGAAACTTGAGGGAATTGTGACTCTGTTCCCTGTTCA
  GGGTCCCCTGCCCTTCTATCTGGGAGCTAGGGAAGGTATGGGGGAGGAAAGAGAATGGATTTATAGCTAC
  CCTTACCCTCACACATACACTTGAAAAAACTTTCAGCCTAGCCAGTTCTAGCCCCTGTCCTCTTAGATAT
  ATCCCCCTTTCTGGGTGAACTATAGGCTCTGTGCCTCTCAGACAAATTCTGATCTCTAAGAGATCCCCAG
  ACCTCACTTGCCTCTGCCTCCATCTTGGCCCTGATTCAACCCTAAGATAATAGCACAACAAAATTCTTCA
  TAAAGATATTTTTATTCACCTGTTCCGTGCTATATGGAGGAGGCCAAGTCCATTTAGTGACATTTCTTCC
  CATAATGTGAGTGGGGAGGATTGTGGGGAGGAGGGGCTTTGGGTTCCTGTGTTTGTGCATATGAAGGGAG
  ATGGGGGTTAGGTGGAGGAGGAGAGCAGCGTGGTTAGCTAAGGTTATTGCTTTTTGTGGCAAATCTAATT
  AAATGACAGGAATCTCTTCACGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_212461.1
• Summary: 'The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]'
• Locus ID: 5571